Incidental Mutation 'R4400:Ucp2'
ID326586
Institutional Source Beutler Lab
Gene Symbol Ucp2
Ensembl Gene ENSMUSG00000033685
Gene Nameuncoupling protein 2 (mitochondrial, proton carrier)
Synonyms
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100493337-100502020 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 100499350 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 310 (*310W)
Ref Sequence ENSEMBL: ENSMUSP00000120967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126534] [ENSMUST00000129324] [ENSMUST00000133044] [ENSMUST00000153287] [ENSMUST00000154516] [ENSMUST00000207405] [ENSMUST00000207748]
PDB Structure Structure of the mitochondrial uncoupling protein 2 determined by NMR molecular fragment replacement [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000054923
SMART Domains Protein: ENSMUSP00000059074
Gene: ENSMUSG00000030708

DomainStartEndE-ValueType
DnaJ 3 60 3.52e-23 SMART
Pfam:DnaJ_C 140 299 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126381
Predicted Effect probably null
Transcript: ENSMUST00000126534
AA Change: *310W
SMART Domains Protein: ENSMUSP00000120967
Gene: ENSMUSG00000033685
AA Change: *310W

DomainStartEndE-ValueType
Pfam:Mito_carr 10 111 1.3e-21 PFAM
Pfam:Mito_carr 112 208 2e-27 PFAM
Pfam:Mito_carr 211 302 5.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129324
SMART Domains Protein: ENSMUSP00000115648
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 65 8.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130534
Predicted Effect probably benign
Transcript: ENSMUST00000133044
SMART Domains Protein: ENSMUSP00000115598
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 2.6e-23 PFAM
Pfam:Mito_carr 112 172 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151221
Predicted Effect probably benign
Transcript: ENSMUST00000153287
SMART Domains Protein: ENSMUSP00000115953
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154516
Predicted Effect probably benign
Transcript: ENSMUST00000207405
Predicted Effect probably benign
Transcript: ENSMUST00000207748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207890
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have elevated pancreatic islet cell ATP levels and increased glucose-stimulated secretion of insulin. Homozygotes also show reduced mitochondrial proton leak in thymocytes and increased resistance to infection by Toxoplasma gondii. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Ucp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Ucp2 APN 7 100498422 missense probably benign
IGL02184:Ucp2 APN 7 100499322 missense probably benign
IGL02370:Ucp2 APN 7 100498384 missense probably damaging 0.96
IGL02449:Ucp2 APN 7 100498810 missense probably damaging 1.00
R1808:Ucp2 UTSW 7 100498814 missense probably damaging 0.97
R1809:Ucp2 UTSW 7 100498399 missense probably damaging 0.98
R2384:Ucp2 UTSW 7 100498254 missense probably benign
R2508:Ucp2 UTSW 7 100498413 missense probably benign
R2866:Ucp2 UTSW 7 100497252 missense probably benign 0.31
R5022:Ucp2 UTSW 7 100498372 missense possibly damaging 0.74
R6073:Ucp2 UTSW 7 100498131 missense possibly damaging 0.96
R6530:Ucp2 UTSW 7 100498223 missense probably benign
R7381:Ucp2 UTSW 7 100498369 missense possibly damaging 0.94
R7572:Ucp2 UTSW 7 100497307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCCAGTGGTTAGAAGCAG -3'
(R):5'- AACATTGAGCTTGCTTTATGGG -3'

Sequencing Primer
(F):5'- AGGTGGTGGAGGGACCTC -3'
(R):5'- GCTTAGCTGTAGAAAGGGCTG -3'
Posted On2015-07-07