Incidental Mutation 'R4400:Muc5b'
ID 326589
Institutional Source Beutler Lab
Gene Symbol Muc5b
Ensembl Gene ENSMUSG00000066108
Gene Name mucin 5, subtype B, tracheobronchial
Synonyms MUC5, MUC9, 2300002I04Rik
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R4400 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 141839070-141873084 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141861387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2690 (D2690G)
Ref Sequence ENSEMBL: ENSMUSP00000128276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165147]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000165147
AA Change: D2690G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: D2690G

signal peptide 1 25 N/A INTRINSIC
VWD 73 228 1.12e-25 SMART
C8 267 330 7.26e-8 SMART
Pfam:TIL 333 389 1.1e-13 PFAM
VWC 391 459 1.35e-1 SMART
VWD 418 582 2.87e-37 SMART
C8 619 693 2.53e-30 SMART
Pfam:TIL 699 756 2.6e-10 PFAM
VWC 758 823 1.26e0 SMART
VWC 861 930 1.58e-7 SMART
VWD 888 1048 3e-40 SMART
C8 1084 1158 3.75e-33 SMART
low complexity region 1314 1328 N/A INTRINSIC
Pfam:Mucin2_WxxW 1345 1432 6.7e-27 PFAM
low complexity region 1447 1468 N/A INTRINSIC
low complexity region 1498 1517 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
Pfam:Mucin2_WxxW 1574 1663 2.1e-26 PFAM
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1728 1745 N/A INTRINSIC
low complexity region 1778 1831 N/A INTRINSIC
Pfam:Mucin2_WxxW 1870 1959 2.7e-26 PFAM
low complexity region 1967 1990 N/A INTRINSIC
low complexity region 2024 2041 N/A INTRINSIC
low complexity region 2074 2127 N/A INTRINSIC
Pfam:Mucin2_WxxW 2184 2273 2.1e-26 PFAM
low complexity region 2281 2304 N/A INTRINSIC
low complexity region 2338 2355 N/A INTRINSIC
low complexity region 2388 2441 N/A INTRINSIC
Pfam:Mucin2_WxxW 2498 2587 2.1e-26 PFAM
low complexity region 2596 2618 N/A INTRINSIC
low complexity region 2623 2654 N/A INTRINSIC
low complexity region 2660 2681 N/A INTRINSIC
Pfam:Mucin2_WxxW 2687 2776 3.8e-25 PFAM
low complexity region 2781 2796 N/A INTRINSIC
low complexity region 2958 3009 N/A INTRINSIC
Pfam:Mucin2_WxxW 3066 3155 2.6e-26 PFAM
low complexity region 3220 3237 N/A INTRINSIC
low complexity region 3270 3317 N/A INTRINSIC
Pfam:Mucin2_WxxW 3380 3469 3.4e-26 PFAM
low complexity region 3509 3529 N/A INTRINSIC
low complexity region 3546 3562 N/A INTRINSIC
low complexity region 3568 3591 N/A INTRINSIC
Pfam:Mucin2_WxxW 3624 3713 2.6e-27 PFAM
Pfam:Mucin2_WxxW 3778 3867 3.2e-24 PFAM
low complexity region 3883 3900 N/A INTRINSIC
low complexity region 3910 3934 N/A INTRINSIC
low complexity region 3959 3976 N/A INTRINSIC
low complexity region 4033 4053 N/A INTRINSIC
VWD 4111 4283 6.75e-34 SMART
C8 4336 4403 4.26e-14 SMART
VWC 4461 4530 7.06e-5 SMART
VWC 4570 4631 6.53e-9 SMART
CT 4708 4790 2.93e-26 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Muc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Muc5b APN 7 141841392 missense unknown
IGL00677:Muc5b APN 7 141857894 nonsense probably null
IGL00740:Muc5b APN 7 141855598 missense unknown
IGL01084:Muc5b APN 7 141843449 splice site probably benign
IGL01384:Muc5b APN 7 141846818 missense unknown
IGL01447:Muc5b APN 7 141863094 missense probably benign 0.01
IGL01510:Muc5b APN 7 141859061 missense unknown
IGL01532:Muc5b APN 7 141870006 missense possibly damaging 0.96
IGL01556:Muc5b APN 7 141863240 missense probably benign 0.01
IGL01608:Muc5b APN 7 141846437 missense unknown
IGL01884:Muc5b APN 7 141868083 splice site probably benign
IGL01943:Muc5b APN 7 141861497 missense possibly damaging 0.71
IGL02039:Muc5b APN 7 141871164 missense possibly damaging 0.96
IGL02089:Muc5b APN 7 141863250 missense probably benign 0.04
IGL02110:Muc5b APN 7 141847716 nonsense probably null
IGL02123:Muc5b APN 7 141863757 missense possibly damaging 0.68
IGL02124:Muc5b APN 7 141855632 missense unknown
IGL02141:Muc5b APN 7 141853367 missense unknown
IGL02409:Muc5b APN 7 141861338 missense possibly damaging 0.53
IGL02448:Muc5b APN 7 141868489 missense possibly damaging 0.53
IGL02503:Muc5b APN 7 141867667 missense probably benign 0.33
IGL02504:Muc5b APN 7 141846440 missense unknown
IGL02528:Muc5b APN 7 141864017 missense probably benign 0.01
IGL02534:Muc5b APN 7 141844719 missense unknown
IGL02565:Muc5b APN 7 141857867 missense unknown
IGL02630:Muc5b APN 7 141863231 missense probably benign 0.03
IGL02881:Muc5b APN 7 141857712 missense unknown
IGL02963:Muc5b APN 7 141864264 missense probably damaging 1.00
IGL03003:Muc5b APN 7 141863614 missense probably benign 0.03
IGL03013:Muc5b APN 7 141863928 missense possibly damaging 0.68
IGL03102:Muc5b APN 7 141863069 missense probably benign 0.35
IGL03114:Muc5b APN 7 141858819 nonsense probably null
IGL03150:Muc5b APN 7 141865509 missense possibly damaging 0.53
IGL03185:Muc5b APN 7 141862822 missense possibly damaging 0.83
IGL03299:Muc5b APN 7 141841380 missense unknown
IGL03336:Muc5b APN 7 141864363 missense probably damaging 1.00
IGL03370:Muc5b APN 7 141864777 missense probably benign 0.34
IGL03375:Muc5b APN 7 141861962 missense possibly damaging 0.53
IGL03393:Muc5b APN 7 141864138 missense probably benign 0.21
profligate UTSW 7 141857822 nonsense probably null
wasteful UTSW 7 141858161 missense unknown
R0045:Muc5b UTSW 7 141856818 missense unknown
R0256:Muc5b UTSW 7 141841395 missense unknown
R0256:Muc5b UTSW 7 141843258 missense unknown
R0321:Muc5b UTSW 7 141862235 missense probably benign 0.19
R0391:Muc5b UTSW 7 141865082 missense possibly damaging 0.73
R0458:Muc5b UTSW 7 141864972 missense probably benign 0.20
R0491:Muc5b UTSW 7 141862015 missense probably benign 0.01
R0543:Muc5b UTSW 7 141851785 missense unknown
R0583:Muc5b UTSW 7 141856698 nonsense probably null
R0611:Muc5b UTSW 7 141862436 missense probably benign 0.18
R0625:Muc5b UTSW 7 141846427 missense unknown
R0655:Muc5b UTSW 7 141863942 missense probably benign 0.01
R0845:Muc5b UTSW 7 141850446 splice site probably null
R0863:Muc5b UTSW 7 141867717 missense probably benign 0.18
R0965:Muc5b UTSW 7 141863802 missense possibly damaging 0.92
R0988:Muc5b UTSW 7 141871795 missense probably benign 0.03
R1140:Muc5b UTSW 7 141858996 missense unknown
R1209:Muc5b UTSW 7 141857910 missense unknown
R1333:Muc5b UTSW 7 141868407 missense possibly damaging 0.53
R1337:Muc5b UTSW 7 141858624 missense unknown
R1385:Muc5b UTSW 7 141862137 missense probably benign 0.00
R1463:Muc5b UTSW 7 141859080 missense unknown
R1471:Muc5b UTSW 7 141843234 missense unknown
R1617:Muc5b UTSW 7 141863524 nonsense probably null
R1736:Muc5b UTSW 7 141859107 missense unknown
R1752:Muc5b UTSW 7 141867751 missense possibly damaging 0.96
R1804:Muc5b UTSW 7 141863780 missense possibly damaging 0.68
R1806:Muc5b UTSW 7 141865493 missense possibly damaging 0.68
R1895:Muc5b UTSW 7 141857645 missense unknown
R1902:Muc5b UTSW 7 141864105 missense possibly damaging 0.77
R1919:Muc5b UTSW 7 141846031 missense unknown
R1924:Muc5b UTSW 7 141868223 missense possibly damaging 0.53
R1942:Muc5b UTSW 7 141857684 missense unknown
R1959:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1960:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1976:Muc5b UTSW 7 141863154 missense probably benign 0.01
R2080:Muc5b UTSW 7 141869754 missense probably benign 0.33
R2178:Muc5b UTSW 7 141864116 missense possibly damaging 0.58
R2184:Muc5b UTSW 7 141858864 nonsense probably null
R2229:Muc5b UTSW 7 141861644 missense possibly damaging 0.71
R2237:Muc5b UTSW 7 141862089 missense probably benign 0.00
R2509:Muc5b UTSW 7 141859061 missense unknown
R2510:Muc5b UTSW 7 141859061 missense unknown
R2512:Muc5b UTSW 7 141859076 missense unknown
R2888:Muc5b UTSW 7 141861554 missense probably damaging 0.98
R3054:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3055:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3108:Muc5b UTSW 7 141858759 missense unknown
R3109:Muc5b UTSW 7 141858759 missense unknown
R3113:Muc5b UTSW 7 141846134 missense unknown
R3551:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141867705 missense probably benign 0.18
R3622:Muc5b UTSW 7 141851858 splice site probably benign
R3700:Muc5b UTSW 7 141847249 missense unknown
R3734:Muc5b UTSW 7 141859037 nonsense probably null
R3785:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3786:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3788:Muc5b UTSW 7 141863834 missense possibly damaging 0.68
R3810:Muc5b UTSW 7 141864126 missense possibly damaging 0.58
R3834:Muc5b UTSW 7 141859181 missense unknown
R3835:Muc5b UTSW 7 141859181 missense unknown
R3850:Muc5b UTSW 7 141862638 missense possibly damaging 0.95
R3877:Muc5b UTSW 7 141857552 missense unknown
R3909:Muc5b UTSW 7 141849498 missense unknown
R3964:Muc5b UTSW 7 141866968 missense possibly damaging 0.73
R4014:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4015:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4017:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4042:Muc5b UTSW 7 141864887 missense possibly damaging 0.92
R4200:Muc5b UTSW 7 141858925 nonsense probably null
R4230:Muc5b UTSW 7 141863522 missense probably benign 0.03
R4455:Muc5b UTSW 7 141858818 missense unknown
R4484:Muc5b UTSW 7 141868450 missense possibly damaging 0.73
R4630:Muc5b UTSW 7 141857984 missense unknown
R4646:Muc5b UTSW 7 141862640 missense probably benign 0.34
R4658:Muc5b UTSW 7 141841398 missense unknown
R4667:Muc5b UTSW 7 141842379 missense unknown
R4690:Muc5b UTSW 7 141842294 missense unknown
R4697:Muc5b UTSW 7 141857361 missense unknown
R4711:Muc5b UTSW 7 141846033 missense unknown
R4713:Muc5b UTSW 7 141849079 nonsense probably null
R4749:Muc5b UTSW 7 141861448 nonsense probably null
R4753:Muc5b UTSW 7 141856853 missense unknown
R4782:Muc5b UTSW 7 141847716 nonsense probably null
R4795:Muc5b UTSW 7 141849567 missense unknown
R4796:Muc5b UTSW 7 141864246 missense possibly damaging 0.52
R4799:Muc5b UTSW 7 141847716 nonsense probably null
R4824:Muc5b UTSW 7 141864185 missense probably damaging 1.00
R4825:Muc5b UTSW 7 141868465 missense possibly damaging 0.96
R5068:Muc5b UTSW 7 141858608 missense unknown
R5073:Muc5b UTSW 7 141859262 missense unknown
R5074:Muc5b UTSW 7 141859262 missense unknown
R5107:Muc5b UTSW 7 141855531 missense unknown
R5152:Muc5b UTSW 7 141865531 missense possibly damaging 0.53
R5183:Muc5b UTSW 7 141850810 missense unknown
R5191:Muc5b UTSW 7 141858539 missense unknown
R5254:Muc5b UTSW 7 141864540 missense probably benign 0.09
R5320:Muc5b UTSW 7 141859001 missense unknown
R5352:Muc5b UTSW 7 141864558 missense possibly damaging 0.66
R5378:Muc5b UTSW 7 141862203 missense unknown
R5417:Muc5b UTSW 7 141858044 missense unknown
R5548:Muc5b UTSW 7 141863942 missense probably benign 0.01
R5551:Muc5b UTSW 7 141868503 missense possibly damaging 0.73
R5562:Muc5b UTSW 7 141847238 missense unknown
R5580:Muc5b UTSW 7 141861347 missense possibly damaging 0.53
R5629:Muc5b UTSW 7 141861299 missense possibly damaging 0.73
R5758:Muc5b UTSW 7 141858983 missense unknown
R5783:Muc5b UTSW 7 141858428 nonsense probably null
R5795:Muc5b UTSW 7 141871741 missense possibly damaging 0.96
R5796:Muc5b UTSW 7 141857396 missense unknown
R5797:Muc5b UTSW 7 141851582 missense unknown
R5806:Muc5b UTSW 7 141862835 missense possibly damaging 0.68
R5888:Muc5b UTSW 7 141858421 missense unknown
R5910:Muc5b UTSW 7 141861311 missense possibly damaging 0.53
R5956:Muc5b UTSW 7 141864173 missense probably damaging 0.99
R5970:Muc5b UTSW 7 141856712 missense unknown
R5990:Muc5b UTSW 7 141858161 missense unknown
R5999:Muc5b UTSW 7 141857379 missense unknown
R6001:Muc5b UTSW 7 141872381 missense possibly damaging 0.72
R6053:Muc5b UTSW 7 141864708 missense probably benign 0.07
R6073:Muc5b UTSW 7 141849060 missense unknown
R6073:Muc5b UTSW 7 141858288 missense unknown
R6112:Muc5b UTSW 7 141863305 missense probably benign 0.01
R6153:Muc5b UTSW 7 141861444 missense possibly damaging 0.71
R6164:Muc5b UTSW 7 141863345 missense possibly damaging 0.73
R6172:Muc5b UTSW 7 141858776 missense unknown
R6178:Muc5b UTSW 7 141856342 missense probably null
R6196:Muc5b UTSW 7 141851596 missense unknown
R6213:Muc5b UTSW 7 141862166 missense probably benign 0.00
R6213:Muc5b UTSW 7 141867619 missense possibly damaging 0.92
R6344:Muc5b UTSW 7 141862971 missense possibly damaging 0.62
R6400:Muc5b UTSW 7 141858665 missense unknown
R6414:Muc5b UTSW 7 141859097 missense unknown
R6521:Muc5b UTSW 7 141859171 nonsense probably null
R6658:Muc5b UTSW 7 141868507 critical splice donor site probably null
R6717:Muc5b UTSW 7 141857822 nonsense probably null
R6737:Muc5b UTSW 7 141857499 missense unknown
R6763:Muc5b UTSW 7 141862284 missense probably benign 0.01
R6817:Muc5b UTSW 7 141862913 missense probably benign 0.06
R6819:Muc5b UTSW 7 141858863 missense unknown
R6916:Muc5b UTSW 7 141864717 missense possibly damaging 0.71
R7030:Muc5b UTSW 7 141842455 missense unknown
R7116:Muc5b UTSW 7 141863750 missense probably benign 0.10
R7134:Muc5b UTSW 7 141857654 missense unknown
R7146:Muc5b UTSW 7 141863967 missense possibly damaging 0.96
R7168:Muc5b UTSW 7 141864017 missense probably benign 0.01
R7182:Muc5b UTSW 7 141842645 missense unknown
R7189:Muc5b UTSW 7 141861061 nonsense probably null
R7207:Muc5b UTSW 7 141862865 missense probably benign 0.01
R7232:Muc5b UTSW 7 141866129 missense possibly damaging 0.53
R7260:Muc5b UTSW 7 141842648 missense unknown
R7269:Muc5b UTSW 7 141857535 missense unknown
R7273:Muc5b UTSW 7 141851570 missense unknown
R7278:Muc5b UTSW 7 141857502 missense unknown
R7307:Muc5b UTSW 7 141842294 missense unknown
R7323:Muc5b UTSW 7 141858707 missense unknown
R7374:Muc5b UTSW 7 141863126 missense probably benign 0.10
R7376:Muc5b UTSW 7 141872550 missense possibly damaging 0.53
R7382:Muc5b UTSW 7 141858948 missense unknown
R7481:Muc5b UTSW 7 141861171 missense unknown
R7497:Muc5b UTSW 7 141861513 missense possibly damaging 0.92
R7554:Muc5b UTSW 7 141858776 missense unknown
R7571:Muc5b UTSW 7 141847249 missense unknown
R7598:Muc5b UTSW 7 141859262 missense unknown
R7609:Muc5b UTSW 7 141861729 missense possibly damaging 0.86
R7615:Muc5b UTSW 7 141864892 nonsense probably null
R7618:Muc5b UTSW 7 141867597 missense probably benign 0.01
R7651:Muc5b UTSW 7 141864023 missense possibly damaging 0.75
R7692:Muc5b UTSW 7 141853229 missense unknown
R7731:Muc5b UTSW 7 141857305 critical splice acceptor site probably null
R7746:Muc5b UTSW 7 141862239 missense probably benign 0.10
R7748:Muc5b UTSW 7 141847805 missense unknown
R7774:Muc5b UTSW 7 141842379 missense unknown
R7783:Muc5b UTSW 7 141857341 missense unknown
R7834:Muc5b UTSW 7 141859070 missense unknown
R7872:Muc5b UTSW 7 141846113 missense unknown
R7935:Muc5b UTSW 7 141846832 missense unknown
R8026:Muc5b UTSW 7 141863636 missense probably benign 0.03
R8036:Muc5b UTSW 7 141867741 missense possibly damaging 0.73
R8081:Muc5b UTSW 7 141864006 missense possibly damaging 0.88
R8096:Muc5b UTSW 7 141849555 missense unknown
R8101:Muc5b UTSW 7 141865175 missense possibly damaging 0.53
R8112:Muc5b UTSW 7 141862028 missense possibly damaging 0.53
R8131:Muc5b UTSW 7 141842409 missense unknown
R8170:Muc5b UTSW 7 141861000 missense unknown
R8171:Muc5b UTSW 7 141861000 missense unknown
R8191:Muc5b UTSW 7 141867684 missense probably benign 0.18
R8237:Muc5b UTSW 7 141857960 missense unknown
R8342:Muc5b UTSW 7 141860865 missense unknown
R8343:Muc5b UTSW 7 141864161 missense probably benign 0.28
R8389:Muc5b UTSW 7 141861779 missense possibly damaging 0.53
R8396:Muc5b UTSW 7 141851815 missense unknown
R8733:Muc5b UTSW 7 141863795 missense possibly damaging 0.68
R8774:Muc5b UTSW 7 141865094 missense probably benign 0.18
R8774-TAIL:Muc5b UTSW 7 141865094 missense probably benign 0.18
R8833:Muc5b UTSW 7 141858368 missense unknown
R8884:Muc5b UTSW 7 141849419 missense unknown
R8907:Muc5b UTSW 7 141864138 missense probably benign 0.21
R8944:Muc5b UTSW 7 141867378 missense
R9025:Muc5b UTSW 7 141872472 missense probably damaging 0.98
R9044:Muc5b UTSW 7 141858058 missense unknown
R9117:Muc5b UTSW 7 141869333 missense possibly damaging 0.73
R9145:Muc5b UTSW 7 141857613 missense unknown
R9154:Muc5b UTSW 7 141864237 missense probably damaging 0.98
R9177:Muc5b UTSW 7 141845338 missense unknown
R9190:Muc5b UTSW 7 141858202 missense unknown
R9204:Muc5b UTSW 7 141856392 missense unknown
R9260:Muc5b UTSW 7 141851518 missense unknown
R9331:Muc5b UTSW 7 141857738 missense unknown
R9366:Muc5b UTSW 7 141863304 missense probably benign 0.01
R9402:Muc5b UTSW 7 141845414 missense unknown
R9462:Muc5b UTSW 7 141861479 missense
R9463:Muc5b UTSW 7 141851766 missense unknown
R9490:Muc5b UTSW 7 141871760 missense probably benign 0.33
R9523:Muc5b UTSW 7 141842379 missense unknown
R9548:Muc5b UTSW 7 141867911 missense possibly damaging 0.52
R9591:Muc5b UTSW 7 141858779 missense unknown
Z1088:Muc5b UTSW 7 141862214 missense probably benign 0.01
Z1176:Muc5b UTSW 7 141842705 missense unknown
Z1177:Muc5b UTSW 7 141863173 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-07