Incidental Mutation 'R4400:Trim60'
ID326591
Institutional Source Beutler Lab
Gene Symbol Trim60
Ensembl Gene ENSMUSG00000053490
Gene Nametripartite motif-containing 60
SynonymsRnf33, 2czf45
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location64999307-65018584 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 65001212 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 128 (Y128*)
Ref Sequence ENSEMBL: ENSMUSP00000040299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048565]
Predicted Effect probably null
Transcript: ENSMUST00000048565
AA Change: Y128*
SMART Domains Protein: ENSMUSP00000040299
Gene: ENSMUSG00000053490
AA Change: Y128*

DomainStartEndE-ValueType
RING 15 55 1.48e-7 SMART
low complexity region 81 90 N/A INTRINSIC
BBOX 91 132 3.12e-6 SMART
PRY 289 341 4.11e-15 SMART
Pfam:SPRY 344 459 2e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. Pseudogenes of this gene are located on more than six chromosomes including chromosome 4. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Trim60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Trim60 APN 8 65000719 missense possibly damaging 0.61
IGL03145:Trim60 APN 8 65000572 missense probably damaging 0.99
R0054:Trim60 UTSW 8 65001321 missense probably benign 0.05
R0054:Trim60 UTSW 8 65001321 missense probably benign 0.05
R0080:Trim60 UTSW 8 65000599 missense probably damaging 1.00
R0244:Trim60 UTSW 8 65001048 missense probably benign 0.07
R0348:Trim60 UTSW 8 65001216 missense probably damaging 1.00
R1104:Trim60 UTSW 8 65001419 missense probably benign 0.04
R1615:Trim60 UTSW 8 65000510 nonsense probably null
R1667:Trim60 UTSW 8 65001464 missense probably benign 0.00
R1944:Trim60 UTSW 8 65001312 missense possibly damaging 0.95
R2009:Trim60 UTSW 8 65001323 missense probably damaging 0.99
R4093:Trim60 UTSW 8 65001378 missense probably benign 0.05
R5171:Trim60 UTSW 8 65000524 missense probably benign 0.05
R5898:Trim60 UTSW 8 65000364 nonsense probably null
R6586:Trim60 UTSW 8 65000596 missense possibly damaging 0.61
R7012:Trim60 UTSW 8 65000391 missense possibly damaging 0.93
R7092:Trim60 UTSW 8 65001048 missense probably benign 0.07
R7274:Trim60 UTSW 8 65000481 missense possibly damaging 0.76
R7567:Trim60 UTSW 8 65001525 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGGCTCTCATTTAGATGCGC -3'
(R):5'- CAGTTCCGTAACATGACTGAAACC -3'

Sequencing Primer
(F):5'- GCTTCGTACTCACTTTGTAGGAACAG -3'
(R):5'- TGACTGAAACCATTAGGCTCCTG -3'
Posted On2015-07-07