Incidental Mutation 'R4400:Galnt2'
ID 326592
Institutional Source Beutler Lab
Gene Symbol Galnt2
Ensembl Gene ENSMUSG00000089704
Gene Name polypeptide N-acetylgalactosaminyltransferase 2
Synonyms ppGaNTase-T2
MMRRC Submission 041131-MU
Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R4400 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 124231391-124345724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124324303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 157 (K157E)
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]
AlphaFold Q6PB93
Predicted Effect probably damaging
Transcript: ENSMUST00000034458
AA Change: K191E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: K191E

signal peptide 1 20 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glycos_transf_2 138 321 8.3e-31 PFAM
Pfam:Glyco_transf_7C 295 365 5.4e-8 PFAM
RICIN 440 565 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127664
AA Change: K157E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: K157E

Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159796
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI


Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Galnt2 APN 8 124305506 splice site probably benign
IGL02638:Galnt2 APN 8 124231579 missense probably damaging 0.98
chivalry UTSW 8 124334286 nonsense probably null
feudal UTSW 8 124332098 critical splice donor site probably null
gallantry UTSW 8 124340822 missense probably damaging 1.00
valor UTSW 8 124329788 missense probably damaging 1.00
P0018:Galnt2 UTSW 8 124336611 missense probably damaging 1.00
R0133:Galnt2 UTSW 8 124338538 missense probably benign 0.19
R0453:Galnt2 UTSW 8 124338584 splice site probably benign
R0709:Galnt2 UTSW 8 124343346 missense probably benign 0.01
R1015:Galnt2 UTSW 8 124336617 missense probably benign
R4388:Galnt2 UTSW 8 124295453 critical splice donor site probably null
R4447:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4448:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4449:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4450:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4927:Galnt2 UTSW 8 124305623 missense probably damaging 1.00
R5536:Galnt2 UTSW 8 124323673 missense probably damaging 1.00
R6218:Galnt2 UTSW 8 124343315 missense probably benign 0.01
R6732:Galnt2 UTSW 8 124340822 missense probably damaging 1.00
R6795:Galnt2 UTSW 8 124343436 missense probably damaging 1.00
R6823:Galnt2 UTSW 8 124324011 missense probably benign
R7173:Galnt2 UTSW 8 124305553 missense probably benign 0.00
R7479:Galnt2 UTSW 8 124334338 missense probably damaging 1.00
R7818:Galnt2 UTSW 8 124329788 missense probably damaging 1.00
R7821:Galnt2 UTSW 8 124343395 missense possibly damaging 0.51
R7831:Galnt2 UTSW 8 124332078 missense probably benign 0.04
R8348:Galnt2 UTSW 8 124334286 nonsense probably null
R8770:Galnt2 UTSW 8 124334286 nonsense probably null
R8826:Galnt2 UTSW 8 124305608 missense probably damaging 1.00
R9054:Galnt2 UTSW 8 124332098 critical splice donor site probably null
R9269:Galnt2 UTSW 8 124338463 missense probably benign 0.02
X0024:Galnt2 UTSW 8 124343345 missense probably benign 0.28
Z1177:Galnt2 UTSW 8 124343318 missense probably benign 0.24
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-07