Incidental Mutation 'R4400:Tspoap1'
ID 326599
Institutional Source Beutler Lab
Gene Symbol Tspoap1
Ensembl Gene ENSMUSG00000034156
Gene Name TSPO associated protein 1
Synonyms Bzrap1, peripheral
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4400 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87760541-87785928 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87775603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 947 (S947P)
Ref Sequence ENSEMBL: ENSMUSP00000098209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]
AlphaFold Q7TNF8
Predicted Effect probably damaging
Transcript: ENSMUST00000039627
AA Change: S1007P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: S1007P

coiled coil region 121 190 N/A INTRINSIC
coiled coil region 219 249 N/A INTRINSIC
low complexity region 301 309 N/A INTRINSIC
coiled coil region 331 519 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
SH3 652 715 1.85e-11 SMART
low complexity region 733 759 N/A INTRINSIC
FN3 784 864 3.14e0 SMART
FN3 878 951 4.81e-4 SMART
FN3 975 1062 7.16e0 SMART
low complexity region 1254 1265 N/A INTRINSIC
low complexity region 1301 1313 N/A INTRINSIC
low complexity region 1387 1401 N/A INTRINSIC
low complexity region 1455 1471 N/A INTRINSIC
SH3 1619 1683 5.4e-13 SMART
low complexity region 1721 1732 N/A INTRINSIC
SH3 1758 1821 5.48e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100644
AA Change: S947P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: S947P

coiled coil region 121 190 N/A INTRINSIC
low complexity region 241 249 N/A INTRINSIC
coiled coil region 271 459 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
SH3 592 655 1.85e-11 SMART
low complexity region 673 699 N/A INTRINSIC
FN3 724 804 3.14e0 SMART
FN3 818 891 4.81e-4 SMART
FN3 915 1002 7.16e0 SMART
low complexity region 1194 1205 N/A INTRINSIC
low complexity region 1241 1253 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1395 1411 N/A INTRINSIC
SH3 1559 1623 5.4e-13 SMART
low complexity region 1661 1672 N/A INTRINSIC
SH3 1698 1761 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133645
SMART Domains Protein: ENSMUSP00000117356
Gene: ENSMUSG00000034156

low complexity region 39 50 N/A INTRINSIC
SH3 88 151 5.48e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135957
Predicted Effect probably benign
Transcript: ENSMUST00000142329
SMART Domains Protein: ENSMUSP00000118819
Gene: ENSMUSG00000034156

low complexity region 72 83 N/A INTRINSIC
SH3 157 221 5.4e-13 SMART
low complexity region 259 270 N/A INTRINSIC
SH3 296 359 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144502
SMART Domains Protein: ENSMUSP00000122665
Gene: ENSMUSG00000034156

low complexity region 146 157 N/A INTRINSIC
PDB:2CSQ|A 223 250 8e-8 PDB
Blast:SH3 231 251 5e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153578
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous double-KO with Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Tspoap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Tspoap1 APN 11 87777821 splice site probably null
IGL01718:Tspoap1 APN 11 87780255 missense possibly damaging 0.90
IGL02427:Tspoap1 APN 11 87762515 missense probably benign 0.00
IGL02487:Tspoap1 APN 11 87762516 missense possibly damaging 0.90
IGL02730:Tspoap1 APN 11 87781709 missense probably damaging 0.98
IGL02979:Tspoap1 APN 11 87770521 missense probably damaging 1.00
R0384:Tspoap1 UTSW 11 87766454 missense probably damaging 1.00
R0396:Tspoap1 UTSW 11 87776346 splice site probably benign
R0470:Tspoap1 UTSW 11 87776162 missense probably damaging 0.99
R0637:Tspoap1 UTSW 11 87777240 splice site probably benign
R0671:Tspoap1 UTSW 11 87762809 missense probably damaging 1.00
R0960:Tspoap1 UTSW 11 87770595 splice site probably benign
R0989:Tspoap1 UTSW 11 87765823 missense probably damaging 0.99
R1396:Tspoap1 UTSW 11 87766120 missense probably damaging 1.00
R1792:Tspoap1 UTSW 11 87765881 splice site probably null
R2901:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R2902:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R3969:Tspoap1 UTSW 11 87762446 missense probably damaging 1.00
R4599:Tspoap1 UTSW 11 87779521 missense probably damaging 1.00
R4635:Tspoap1 UTSW 11 87777857 missense probably benign 0.25
R4731:Tspoap1 UTSW 11 87765647 missense probably benign 0.09
R4755:Tspoap1 UTSW 11 87771663 missense possibly damaging 0.77
R4780:Tspoap1 UTSW 11 87778443 missense possibly damaging 0.48
R4960:Tspoap1 UTSW 11 87766396 nonsense probably null
R5494:Tspoap1 UTSW 11 87775205 missense possibly damaging 0.47
R5687:Tspoap1 UTSW 11 87777126 missense probably damaging 1.00
R6200:Tspoap1 UTSW 11 87761703 missense possibly damaging 0.85
R6563:Tspoap1 UTSW 11 87777159 missense possibly damaging 0.87
R6816:Tspoap1 UTSW 11 87765665 missense probably benign
R6897:Tspoap1 UTSW 11 87765812 missense probably damaging 1.00
R7141:Tspoap1 UTSW 11 87774697 missense probably damaging 1.00
R7215:Tspoap1 UTSW 11 87770489 missense probably benign 0.02
R7341:Tspoap1 UTSW 11 87766379 missense probably damaging 1.00
R7360:Tspoap1 UTSW 11 87778521 missense probably benign 0.09
R7394:Tspoap1 UTSW 11 87766119 nonsense probably null
R7483:Tspoap1 UTSW 11 87761525 missense probably benign 0.00
R7617:Tspoap1 UTSW 11 87763625 missense probably benign 0.02
R7793:Tspoap1 UTSW 11 87764310 missense probably benign 0.00
R7814:Tspoap1 UTSW 11 87775524 missense probably damaging 1.00
R8371:Tspoap1 UTSW 11 87778301 missense probably benign 0.01
R8768:Tspoap1 UTSW 11 87778371 missense probably benign 0.03
R8987:Tspoap1 UTSW 11 87763568 missense probably damaging 1.00
R9004:Tspoap1 UTSW 11 87779458 missense
R9259:Tspoap1 UTSW 11 87779524 missense
R9339:Tspoap1 UTSW 11 87778013 missense probably benign 0.01
R9424:Tspoap1 UTSW 11 87761256 start gained probably benign
R9439:Tspoap1 UTSW 11 87774709 missense probably damaging 0.98
R9455:Tspoap1 UTSW 11 87770533 missense probably damaging 1.00
Z1176:Tspoap1 UTSW 11 87776057 missense possibly damaging 0.51
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-07