Incidental Mutation 'R4400:Cd79b'
ID 326600
Institutional Source Beutler Lab
Gene Symbol Cd79b
Ensembl Gene ENSMUSG00000040592
Gene Name CD79B antigen
Synonyms Igbeta, B29, Ig-beta, Igb
MMRRC Submission 041131-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R4400 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 106202167-106205388 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 106202836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 195 (Y195*)
Ref Sequence ENSEMBL: ENSMUSP00000129029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044228] [ENSMUST00000167143]
AlphaFold P15530
PDB Structure Crystal structure of murine Ig-beta (CD79b) homodimer [X-RAY DIFFRACTION]
Crystal structure of murine Ig-beta (CD79b) in the monomeric form [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000044228
AA Change: Y255*
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592
AA Change: Y255*

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167143
AA Change: Y195*
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592
AA Change: Y195*

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,438,810 (GRCm39) F189L probably damaging Het
Atp8a1 A T 5: 67,922,221 (GRCm39) Y372N probably benign Het
Bves T C 10: 45,245,389 (GRCm39) V354A probably benign Het
Cog6 A C 3: 52,920,362 (GRCm39) D131E probably benign Het
Elp3 C T 14: 65,785,539 (GRCm39) E421K possibly damaging Het
Fbxw28 A T 9: 109,157,378 (GRCm39) F237Y probably damaging Het
Fezf1 T C 6: 23,247,709 (GRCm39) N122S probably benign Het
Galnt2 A G 8: 125,051,042 (GRCm39) K157E probably damaging Het
Git2 T C 5: 114,871,970 (GRCm39) E141G possibly damaging Het
Gm26888 T C 11: 119,044,853 (GRCm39) silent Het
Gnrhr T C 5: 86,330,108 (GRCm39) probably null Het
Hoxd13 A T 2: 74,500,359 (GRCm39) D300V probably damaging Het
Hspg2 G A 4: 137,275,433 (GRCm39) A2748T probably benign Het
Hyal2 A G 9: 107,448,052 (GRCm39) N235S probably damaging Het
Itgam T G 7: 127,680,830 (GRCm39) L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Matr3 A T 18: 35,716,969 (GRCm39) K591N possibly damaging Het
Mep1a T A 17: 43,785,897 (GRCm39) I731F possibly damaging Het
Mrtfa G A 15: 80,905,124 (GRCm39) Q103* probably null Het
Muc5b A G 7: 141,415,124 (GRCm39) D2690G possibly damaging Het
Nlrc5 A G 8: 95,220,981 (GRCm39) Q1140R probably benign Het
Or14c39 A G 7: 86,343,798 (GRCm39) I45V probably benign Het
Or5ac23 C T 16: 59,148,961 (GRCm39) V304I probably benign Het
Or6b6 A G 7: 106,571,209 (GRCm39) L114P probably damaging Het
Plcl1 T C 1: 55,754,736 (GRCm39) F1028L probably damaging Het
Plpp2 A G 10: 79,363,327 (GRCm39) V106A possibly damaging Het
Prpf8 A G 11: 75,381,528 (GRCm39) T255A possibly damaging Het
Shoc2 A G 19: 54,019,660 (GRCm39) I568V probably benign Het
Spopl C T 2: 23,407,957 (GRCm39) V241M probably damaging Het
Ssrp1 A T 2: 84,868,285 (GRCm39) D9V probably damaging Het
Strn3 A T 12: 51,694,883 (GRCm39) D293E possibly damaging Het
Tbx3 G T 5: 119,818,636 (GRCm39) D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 (GRCm39) S416P possibly damaging Het
Trim60 G T 8: 65,453,864 (GRCm39) Y128* probably null Het
Tspoap1 T C 11: 87,666,429 (GRCm39) S947P probably damaging Het
Ttn A T 2: 76,612,739 (GRCm39) S17113R probably damaging Het
Ubqln1 T A 13: 58,341,202 (GRCm39) N183I probably damaging Het
Ubr4 A G 4: 139,189,167 (GRCm39) N3917D possibly damaging Het
Ucp2 A G 7: 100,148,557 (GRCm39) *310W probably null Het
Wdr76 A G 2: 121,359,314 (GRCm39) M218V probably damaging Het
Zranb3 A C 1: 127,884,392 (GRCm39) L998R possibly damaging Het
Zxdc G A 6: 90,346,792 (GRCm39) G51E probably damaging Het
Other mutations in Cd79b
AlleleSourceChrCoordTypePredicted EffectPPH Score
hallasan UTSW 11 106,203,267 (GRCm39) critical splice acceptor site probably null
Jeju UTSW 11 106,203,539 (GRCm39) missense probably damaging 1.00
R0070:Cd79b UTSW 11 106,202,744 (GRCm39) splice site probably benign
R0070:Cd79b UTSW 11 106,202,744 (GRCm39) splice site probably benign
R0731:Cd79b UTSW 11 106,203,259 (GRCm39) missense probably damaging 1.00
R4591:Cd79b UTSW 11 106,202,872 (GRCm39) missense probably damaging 1.00
R4948:Cd79b UTSW 11 106,203,687 (GRCm39) missense probably benign 0.01
R6214:Cd79b UTSW 11 106,203,267 (GRCm39) critical splice acceptor site probably null
R6215:Cd79b UTSW 11 106,203,267 (GRCm39) critical splice acceptor site probably null
R6605:Cd79b UTSW 11 106,203,539 (GRCm39) missense probably damaging 1.00
R7111:Cd79b UTSW 11 106,205,365 (GRCm39) missense possibly damaging 0.73
R7114:Cd79b UTSW 11 106,202,713 (GRCm39) missense probably damaging 1.00
R7401:Cd79b UTSW 11 106,203,678 (GRCm39) missense probably benign 0.02
R8052:Cd79b UTSW 11 106,204,526 (GRCm39) missense probably damaging 0.97
R8790:Cd79b UTSW 11 106,202,873 (GRCm39) missense possibly damaging 0.93
R8921:Cd79b UTSW 11 106,203,632 (GRCm39) missense probably benign 0.07
R9717:Cd79b UTSW 11 106,202,845 (GRCm39) missense probably damaging 1.00
R9753:Cd79b UTSW 11 106,203,457 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGTGACCCTCATTCCTGG -3'
(R):5'- AAGTCCTGTCCATTGGCTC -3'

Sequencing Primer
(F):5'- CATTCCTGGCCTGGATGC -3'
(R):5'- ATTGGCTCCCTGTTCATTCAC -3'
Posted On 2015-07-07