Incidental Mutation 'R4400:Mkl1'
ID326605
Institutional Source Beutler Lab
Gene Symbol Mkl1
Ensembl Gene ENSMUSG00000042292
Gene NameMKL (megakaryoblastic leukemia)/myocardin-like 1
SynonymsMal, MRTF-A, Bsac
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81012281-81190757 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 81020923 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 103 (Q103*)
Ref Sequence ENSEMBL: ENSMUSP00000117745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000149582]
Predicted Effect probably null
Transcript: ENSMUST00000109579
AA Change: Q138*
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292
AA Change: Q138*

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131235
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292
AA Change: Q103*

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134469
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292
AA Change: Q103*

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135047
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292
AA Change: Q103*

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145779
Predicted Effect probably null
Transcript: ENSMUST00000149582
AA Change: Q103*
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292
AA Change: Q103*

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154797
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired mammary myoepithelial cell differentiation and fail to eject milk and productively nurse their offspring. Mice homozygous for another null allele show partial embryonic lethality caused by myocardial necrosis as well as mammary gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Mkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mkl1 APN 15 81016302 missense probably damaging 1.00
IGL02831:Mkl1 APN 15 81104793 missense probably benign 0.14
IGL03060:Mkl1 APN 15 81045322 missense probably damaging 1.00
Betcha UTSW 15 81018448 nonsense probably null
R0594:Mkl1 UTSW 15 81017174 missense probably damaging 1.00
R0648:Mkl1 UTSW 15 81016920 missense probably damaging 1.00
R1085:Mkl1 UTSW 15 81020883 missense probably damaging 1.00
R1476:Mkl1 UTSW 15 81018208 splice site probably benign
R4030:Mkl1 UTSW 15 81015784 missense probably benign 0.01
R4232:Mkl1 UTSW 15 81023595 missense probably damaging 1.00
R4307:Mkl1 UTSW 15 81016347 missense possibly damaging 0.88
R4795:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4796:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4801:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4802:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4899:Mkl1 UTSW 15 81018386 missense probably damaging 1.00
R4967:Mkl1 UTSW 15 81045275 splice site probably benign
R5071:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5072:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5073:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5074:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R6186:Mkl1 UTSW 15 81016652 missense probably damaging 1.00
R6512:Mkl1 UTSW 15 81013716 missense probably benign
R6581:Mkl1 UTSW 15 81016373 missense probably damaging 1.00
R6997:Mkl1 UTSW 15 81018448 nonsense probably null
RF023:Mkl1 UTSW 15 81015856 missense probably damaging 1.00
RF024:Mkl1 UTSW 15 81018255 small deletion probably benign
X0013:Mkl1 UTSW 15 81022436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCCTTGGCAGGTAGAATTC -3'
(R):5'- TGTATGAAGGCCCAACCACAG -3'

Sequencing Primer
(F):5'- CCTTGGCAGGTAGAATTCTAGATTC -3'
(R):5'- TCCTGGCAAGCCTGTTCCAG -3'
Posted On2015-07-07