Incidental Mutation 'R4400:Olfr205'
ID 326606
Institutional Source Beutler Lab
Gene Symbol Olfr205
Ensembl Gene ENSMUSG00000094422
Gene Name olfactory receptor 205
Synonyms MOR182-11P, GA_x54KRFPKG5P-55543875-55542958
MMRRC Submission 041131-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R4400 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 59328005-59331138 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59328598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 304 (V304I)
Ref Sequence ENSEMBL: ENSMUSP00000149415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074125] [ENSMUST00000213910]
AlphaFold Q7TS37
Predicted Effect probably benign
Transcript: ENSMUST00000074125
AA Change: V304I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073762
Gene: ENSMUSG00000094422
AA Change: V304I

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.6e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.6e-7 PFAM
Pfam:7tm_1 40 289 7.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213910
AA Change: V304I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Olfr205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Olfr205 APN 16 59328725 missense probably benign 0.21
IGL03236:Olfr205 APN 16 59328837 missense probably damaging 0.97
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0167:Olfr205 UTSW 16 59328974 nonsense probably null
R0178:Olfr205 UTSW 16 59329420 missense probably damaging 1.00
R0371:Olfr205 UTSW 16 59329222 missense possibly damaging 0.60
R0577:Olfr205 UTSW 16 59328698 missense probably benign 0.01
R0597:Olfr205 UTSW 16 59328760 missense probably damaging 1.00
R0967:Olfr205 UTSW 16 59329183 missense possibly damaging 0.66
R1670:Olfr205 UTSW 16 59329244 missense probably benign 0.03
R1702:Olfr205 UTSW 16 59329141 missense probably benign 0.12
R1995:Olfr205 UTSW 16 59329291 missense probably damaging 1.00
R2239:Olfr205 UTSW 16 59329375 missense probably damaging 0.99
R4063:Olfr205 UTSW 16 59328880 missense probably benign 0.05
R4666:Olfr205 UTSW 16 59329210 missense possibly damaging 0.91
R4795:Olfr205 UTSW 16 59328850 missense probably benign 0.09
R5327:Olfr205 UTSW 16 59329098 missense probably benign 0.01
R5471:Olfr205 UTSW 16 59328631 missense probably damaging 1.00
R5770:Olfr205 UTSW 16 59329151 nonsense probably null
R6195:Olfr205 UTSW 16 59329422 missense possibly damaging 0.81
R6702:Olfr205 UTSW 16 59328598 missense probably benign
R7686:Olfr205 UTSW 16 59329016 missense probably damaging 1.00
R7908:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7911:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7912:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7913:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7998:Olfr205 UTSW 16 59329270 missense probably benign 0.09
R8772:Olfr205 UTSW 16 59328688 missense probably damaging 1.00
R9563:Olfr205 UTSW 16 59329402 missense probably benign 0.00
X0026:Olfr205 UTSW 16 59329350 missense probably benign 0.09
Predicted Primers
Posted On 2015-07-07