Incidental Mutation 'R4400:Matr3'
ID326609
Institutional Source Beutler Lab
Gene Symbol Matr3
Ensembl Gene ENSMUSG00000037236
Gene Namematrin 3
Synonyms2810017I02Rik, D030046F20Rik, 1110061A14Rik
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35562146-35593835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35583916 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 591 (K591N)
Ref Sequence ENSEMBL: ENSMUSP00000140846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166793] [ENSMUST00000186614] [ENSMUST00000186796] [ENSMUST00000187389] [ENSMUST00000187793] [ENSMUST00000188275] [ENSMUST00000188767] [ENSMUST00000189039] [ENSMUST00000189163] [ENSMUST00000190029] [ENSMUST00000190121] [ENSMUST00000190653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166793
AA Change: K591N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125761
Gene: ENSMUSG00000037236
AA Change: K591N

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186158
Predicted Effect probably benign
Transcript: ENSMUST00000186614
SMART Domains Protein: ENSMUSP00000141189
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 2.6e-8 SMART
ZnF_C2H2 291 315 8.8e-2 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186796
AA Change: K253N

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140128
Gene: ENSMUSG00000037236
AA Change: K253N

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187389
AA Change: K591N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139745
Gene: ENSMUSG00000037236
AA Change: K591N

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187793
SMART Domains Protein: ENSMUSP00000140047
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
SCOP:d1lvk_2 42 78 4e-3 SMART
PDB:1X4D|A 52 102 4e-30 PDB
Blast:RRM 61 102 1e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000188275
AA Change: K303N

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140401
Gene: ENSMUSG00000037236
AA Change: K303N

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
RRM 111 181 3.2e-5 SMART
RRM 209 279 2.4e-11 SMART
low complexity region 362 387 N/A INTRINSIC
low complexity region 422 430 N/A INTRINSIC
ZnF_U1 509 544 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188767
SMART Domains Protein: ENSMUSP00000141027
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189019
Predicted Effect probably benign
Transcript: ENSMUST00000189039
SMART Domains Protein: ENSMUSP00000139525
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
ZnF_U1 36 70 2.6e-8 SMART
ZnF_C2H2 39 63 8.8e-2 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189163
Predicted Effect possibly damaging
Transcript: ENSMUST00000190029
AA Change: K591N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140846
Gene: ENSMUSG00000037236
AA Change: K591N

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190121
AA Change: K253N

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140853
Gene: ENSMUSG00000037236
AA Change: K253N

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190653
AA Change: K253N

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141135
Gene: ENSMUSG00000037236
AA Change: K253N

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a gene-trapped allele are early embryonic lethal. Heterozygotes show congenital heart defects including abnormal heart apex morphology, subaortic ventricular septal defects, double-outlet right ventricle, bicuspid aortic valve, aorta coarctation, and patent ductus arteriosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Matr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Matr3 APN 18 35588389 missense probably damaging 1.00
IGL03083:Matr3 APN 18 35572418 missense probably damaging 0.96
IGL03117:Matr3 APN 18 35572657 missense probably damaging 1.00
IGL03163:Matr3 APN 18 35572591 missense probably damaging 0.99
IGL03381:Matr3 APN 18 35579025 splice site probably benign
R0456:Matr3 UTSW 18 35572864 missense probably damaging 1.00
R1136:Matr3 UTSW 18 35572895 missense probably damaging 1.00
R1459:Matr3 UTSW 18 35584656 missense probably benign 0.28
R1850:Matr3 UTSW 18 35582057 missense probably damaging 1.00
R1929:Matr3 UTSW 18 35588325 splice site probably benign
R2185:Matr3 UTSW 18 35581225 missense probably damaging 1.00
R2366:Matr3 UTSW 18 35588395 missense probably damaging 1.00
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2873:Matr3 UTSW 18 35572296 missense probably benign 0.25
R3908:Matr3 UTSW 18 35572841 missense probably damaging 1.00
R4417:Matr3 UTSW 18 35572118 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4881:Matr3 UTSW 18 35572375 missense probably damaging 1.00
R4908:Matr3 UTSW 18 35572701 missense probably damaging 0.96
R5084:Matr3 UTSW 18 35582082 missense probably damaging 0.99
R5660:Matr3 UTSW 18 35572094 missense probably damaging 0.99
R5709:Matr3 UTSW 18 35581962 missense probably damaging 1.00
R5779:Matr3 UTSW 18 35584522 missense possibly damaging 0.81
R5876:Matr3 UTSW 18 35587738 missense probably benign
R6392:Matr3 UTSW 18 35584841 missense probably benign 0.07
R7062:Matr3 UTSW 18 35579019 critical splice donor site probably null
R7156:Matr3 UTSW 18 35572921 missense probably damaging 0.98
R7228:Matr3 UTSW 18 35562484 missense unknown
R7389:Matr3 UTSW 18 35584585 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAGATGAAATTTTAAAATGCAGGCA -3'
(R):5'- GCAGTATACATGGTTAATACTGATTCT -3'

Sequencing Primer
(F):5'- CAGGCAGATTTTTTTGGGTA -3'
(R):5'- CCCGACTATAGATGTGATGTGACC -3'
Posted On2015-07-07