Incidental Mutation 'R4401:Or51f5'
ID 326632
Institutional Source Beutler Lab
Gene Symbol Or51f5
Ensembl Gene ENSMUSG00000073966
Gene Name olfactory receptor family 51 subfamily F member 5
Synonyms GA_x6K02T2PBJ9-5491151-5492095, Olfr561, MOR14-2
MMRRC Submission 041132-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R4401 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102423733-102424677 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 102424006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 92 (R92*)
Ref Sequence ENSEMBL: ENSMUSP00000150963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098217] [ENSMUST00000213432]
AlphaFold Q8VGZ6
Predicted Effect probably null
Transcript: ENSMUST00000098217
AA Change: R92*
SMART Domains Protein: ENSMUSP00000095819
Gene: ENSMUSG00000073966
AA Change: R92*

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 5.1e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 259 9.6e-8 PFAM
Pfam:7tm_1 43 294 4.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213432
AA Change: R92*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,752,390 (GRCm39) I454V possibly damaging Het
Acvr2a A G 2: 48,789,714 (GRCm39) T486A probably benign Het
Ap3b1 C A 13: 94,554,607 (GRCm39) L248I probably damaging Het
Atad2b T A 12: 4,990,145 (GRCm39) C157S probably damaging Het
Cage1 T A 13: 38,207,078 (GRCm39) I256F probably damaging Het
Cct2 A G 10: 116,893,714 (GRCm39) I287T possibly damaging Het
Cntn4 A G 6: 106,466,625 (GRCm39) T176A possibly damaging Het
Cracd G A 5: 76,996,763 (GRCm39) V74I probably damaging Het
Cyp2c54 T C 19: 40,060,615 (GRCm39) N122S probably benign Het
Cytip T C 2: 58,023,947 (GRCm39) D291G probably benign Het
Eef1d C T 15: 75,774,769 (GRCm39) V213I probably benign Het
Fnbp4 A G 2: 90,577,102 (GRCm39) T145A possibly damaging Het
Fras1 C A 5: 96,790,479 (GRCm39) T951K probably damaging Het
Gm11937 C T 11: 99,500,901 (GRCm39) V39M probably damaging Het
Gm6712 C T 17: 17,538,366 (GRCm39) noncoding transcript Het
Hira A G 16: 18,744,470 (GRCm39) I352V probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Lpcat2 T C 8: 93,599,683 (GRCm39) V217A possibly damaging Het
Mroh2a G T 1: 88,182,657 (GRCm39) R1195L possibly damaging Het
Or2a25 G T 6: 42,889,260 (GRCm39) E268* probably null Het
Or4k35 A G 2: 111,100,178 (GRCm39) F178S probably damaging Het
Pla2g1b T A 5: 115,608,947 (GRCm39) Y47* probably null Het
Rfng A T 11: 120,673,306 (GRCm39) V245E possibly damaging Het
Rpf2 A G 10: 40,112,124 (GRCm39) V104A possibly damaging Het
Rps6kc1 G T 1: 190,532,155 (GRCm39) H616N probably benign Het
Slc66a1 T C 4: 139,033,854 (GRCm39) I22V probably benign Het
Slc9b2 T C 3: 135,042,305 (GRCm39) V528A probably benign Het
Srgap1 T C 10: 121,640,826 (GRCm39) probably null Het
Trrap A G 5: 144,780,128 (GRCm39) T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Zfhx4 C A 3: 5,468,405 (GRCm39) Y2854* probably null Het
Zfp986 C T 4: 145,625,513 (GRCm39) R58C probably benign Het
Other mutations in Or51f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Or51f5 APN 7 102,424,114 (GRCm39) missense probably damaging 0.99
IGL02743:Or51f5 APN 7 102,424,505 (GRCm39) missense probably damaging 0.99
IGL03001:Or51f5 APN 7 102,424,460 (GRCm39) missense probably damaging 0.98
R0254:Or51f5 UTSW 7 102,424,076 (GRCm39) nonsense probably null
R0356:Or51f5 UTSW 7 102,424,286 (GRCm39) missense probably damaging 1.00
R0514:Or51f5 UTSW 7 102,424,539 (GRCm39) missense probably benign 0.00
R0725:Or51f5 UTSW 7 102,423,739 (GRCm39) missense probably benign
R0739:Or51f5 UTSW 7 102,423,872 (GRCm39) missense probably damaging 1.00
R1900:Or51f5 UTSW 7 102,424,538 (GRCm39) missense probably benign 0.19
R2080:Or51f5 UTSW 7 102,424,450 (GRCm39) missense probably benign 0.02
R2212:Or51f5 UTSW 7 102,423,962 (GRCm39) missense possibly damaging 0.77
R2379:Or51f5 UTSW 7 102,424,052 (GRCm39) missense probably benign 0.33
R3412:Or51f5 UTSW 7 102,423,962 (GRCm39) missense possibly damaging 0.77
R3834:Or51f5 UTSW 7 102,424,493 (GRCm39) missense probably damaging 1.00
R4117:Or51f5 UTSW 7 102,423,684 (GRCm39) splice site probably null
R4363:Or51f5 UTSW 7 102,424,463 (GRCm39) missense probably benign 0.34
R5176:Or51f5 UTSW 7 102,424,513 (GRCm39) missense probably damaging 0.99
R5464:Or51f5 UTSW 7 102,424,640 (GRCm39) missense probably benign 0.00
R5465:Or51f5 UTSW 7 102,424,640 (GRCm39) missense probably benign 0.00
R5493:Or51f5 UTSW 7 102,424,315 (GRCm39) missense probably benign 0.00
R5540:Or51f5 UTSW 7 102,424,136 (GRCm39) missense probably benign 0.02
R5629:Or51f5 UTSW 7 102,423,847 (GRCm39) missense possibly damaging 0.63
R6227:Or51f5 UTSW 7 102,423,883 (GRCm39) missense probably damaging 0.98
R6367:Or51f5 UTSW 7 102,424,036 (GRCm39) missense possibly damaging 0.92
R6497:Or51f5 UTSW 7 102,424,657 (GRCm39) missense probably benign 0.00
R7219:Or51f5 UTSW 7 102,430,913 (GRCm39) missense probably benign 0.00
R7243:Or51f5 UTSW 7 102,430,865 (GRCm39) missense probably benign
R7289:Or51f5 UTSW 7 102,424,634 (GRCm39) missense probably damaging 1.00
R7560:Or51f5 UTSW 7 102,430,889 (GRCm39) missense probably damaging 1.00
R7731:Or51f5 UTSW 7 102,424,141 (GRCm39) missense probably benign 0.05
R7982:Or51f5 UTSW 7 102,424,310 (GRCm39) missense probably damaging 1.00
R8025:Or51f5 UTSW 7 102,424,463 (GRCm39) missense probably benign 0.34
R8222:Or51f5 UTSW 7 102,424,099 (GRCm39) missense probably damaging 1.00
R8304:Or51f5 UTSW 7 102,423,917 (GRCm39) missense possibly damaging 0.48
R8404:Or51f5 UTSW 7 102,424,134 (GRCm39) nonsense probably null
R8540:Or51f5 UTSW 7 102,424,339 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGACCTCTCACACCTGGATCTC -3'
(R):5'- GCGGTGGTTCCCCTAATTATG -3'

Sequencing Primer
(F):5'- GGATCTCCATCCCTTTCTGTTG -3'
(R):5'- TTATGATTGCAAAACCCACTGC -3'
Posted On 2015-07-07