Incidental Mutation 'R4401:Atad2b'
ID 326642
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4401 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4940145 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 157 (C157S)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably damaging
Transcript: ENSMUST00000045664
AA Change: C157S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: C157S

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219187
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACCCCTTTGAGTGATTTAATAGC -3'
(R):5'- CATGCGTACACTAAAACAGCTG -3'

Sequencing Primer
(F):5'- AGCATACTCTTTTAGTTGGAAATGAC -3'
(R):5'- GCGTACACTAAAACAGCTGAAAAATC -3'
Posted On 2015-07-07