Incidental Mutation 'R4402:Shc1'
ID326658
Institutional Source Beutler Lab
Gene Symbol Shc1
Ensembl Gene ENSMUSG00000042626
Gene Namesrc homology 2 domain-containing transforming protein C1
SynonymsShcA, p66shc, p66
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89418443-89430027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89426678 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 273 (S273P)
Ref Sequence ENSEMBL: ENSMUSP00000140336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039110] [ENSMUST00000060061] [ENSMUST00000094378] [ENSMUST00000107413] [ENSMUST00000107417] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000191485] [ENSMUST00000154791]
Predicted Effect probably benign
Transcript: ENSMUST00000039110
AA Change: S273P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626
AA Change: S273P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060061
SMART Domains Protein: ENSMUSP00000053672
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Blast:SH2 52 78 1e-9 BLAST
low complexity region 115 163 N/A INTRINSIC
low complexity region 177 193 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
PHD 328 382 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094378
AA Change: S383P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626
AA Change: S383P

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107413
SMART Domains Protein: ENSMUSP00000103036
Gene: ENSMUSG00000047824

DomainStartEndE-ValueType
Blast:SH2 15 41 1e-9 BLAST
low complexity region 78 126 N/A INTRINSIC
low complexity region 140 156 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
low complexity region 272 287 N/A INTRINSIC
PHD 291 345 3.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107417
AA Change: S228P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626
AA Change: S228P

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125036
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125830
Predicted Effect probably benign
Transcript: ENSMUST00000128238
AA Change: S255P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626
AA Change: S255P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136573
Predicted Effect probably benign
Transcript: ENSMUST00000137793
AA Change: S273P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626
AA Change: S273P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146037
Predicted Effect probably benign
Transcript: ENSMUST00000191485
AA Change: S273P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626
AA Change: S273P

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146306
Predicted Effect probably benign
Transcript: ENSMUST00000154791
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Shc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Shc1 APN 3 89424229 missense probably damaging 0.99
IGL01608:Shc1 APN 3 89424849 missense probably damaging 0.96
IGL02710:Shc1 APN 3 89424610 splice site probably null
PIT4382001:Shc1 UTSW 3 89427408 missense probably benign 0.00
R0323:Shc1 UTSW 3 89423713 missense probably damaging 0.98
R0445:Shc1 UTSW 3 89426537 missense probably damaging 1.00
R0827:Shc1 UTSW 3 89426783 splice site probably null
R0833:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R0836:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R1155:Shc1 UTSW 3 89424819 missense probably benign 0.30
R1497:Shc1 UTSW 3 89428445 makesense probably null
R1929:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R2271:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R4965:Shc1 UTSW 3 89426996 missense probably damaging 0.98
R5898:Shc1 UTSW 3 89426967 nonsense probably null
R6198:Shc1 UTSW 3 89422107 missense probably benign
R6604:Shc1 UTSW 3 89421879 missense probably damaging 1.00
R6673:Shc1 UTSW 3 89421962 missense possibly damaging 0.93
R6705:Shc1 UTSW 3 89422959 nonsense probably null
R7379:Shc1 UTSW 3 89426822 missense probably benign 0.00
R8041:Shc1 UTSW 3 89422953 missense probably damaging 1.00
R8284:Shc1 UTSW 3 89421908 missense possibly damaging 0.70
R8700:Shc1 UTSW 3 89427433 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTAGAGATTTACACCTGCCTC -3'
(R):5'- TGTCCGTATCAGCAAACTGTG -3'

Sequencing Primer
(F):5'- AGAGATTTACACCTGCCTCTTCTC -3'
(R):5'- AAACTGTGCTCACCTGGG -3'
Posted On2015-07-07