Incidental Mutation 'R4402:Khdrbs1'
ID326663
Institutional Source Beutler Lab
Gene Symbol Khdrbs1
Ensembl Gene ENSMUSG00000028790
Gene NameKH domain containing, RNA binding, signal transduction associated 1
SynonymsSam68, p62
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R4402 (G1)
Quality Score143
Status Not validated
Chromosome4
Chromosomal Location129703164-129742303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129742096 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 22 (D22A)
Ref Sequence ENSEMBL: ENSMUSP00000115402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066257] [ENSMUST00000129342]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066257
AA Change: D22A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066516
Gene: ENSMUSG00000028790
AA Change: D22A

DomainStartEndE-ValueType
low complexity region 34 74 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
KH 154 252 6.91e-11 SMART
low complexity region 281 316 N/A INTRINSIC
low complexity region 326 351 N/A INTRINSIC
Pfam:Sam68-YY 366 415 1.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129342
AA Change: D22A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115402
Gene: ENSMUSG00000028790
AA Change: D22A

DomainStartEndE-ValueType
low complexity region 34 74 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
KH 154 252 6.91e-11 SMART
low complexity region 281 316 N/A INTRINSIC
low complexity region 326 351 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 377 397 N/A INTRINSIC
PDB:3QHE|D 398 419 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139281
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the K homology domain-containing, RNA-binding, signal transduction-associated protein family. The encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene protects mice from age-related bone loss and the formation of fatty bone marrow. Males are infertile and females do not care for young. Some die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Khdrbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Khdrbs1 APN 4 129725669 missense probably benign 0.00
IGL01801:Khdrbs1 APN 4 129741781 missense probably benign
IGL03163:Khdrbs1 APN 4 129725715 missense probably benign 0.40
R1163:Khdrbs1 UTSW 4 129725586 missense possibly damaging 0.48
R1350:Khdrbs1 UTSW 4 129720752 missense probably benign
R2059:Khdrbs1 UTSW 4 129725721 missense probably damaging 1.00
R2192:Khdrbs1 UTSW 4 129720037 critical splice donor site probably null
R2518:Khdrbs1 UTSW 4 129720747 missense probably benign
R3000:Khdrbs1 UTSW 4 129725663 missense probably damaging 1.00
R3552:Khdrbs1 UTSW 4 129720791 missense possibly damaging 0.86
R4623:Khdrbs1 UTSW 4 129720842 missense probably benign 0.07
R5138:Khdrbs1 UTSW 4 129741854 missense probably benign 0.13
R5384:Khdrbs1 UTSW 4 129741936 missense possibly damaging 0.70
R5863:Khdrbs1 UTSW 4 129722700 missense probably damaging 0.99
R5897:Khdrbs1 UTSW 4 129720655 missense probably benign
R6018:Khdrbs1 UTSW 4 129720094 missense probably benign
R6153:Khdrbs1 UTSW 4 129716172 missense probably damaging 0.99
R6185:Khdrbs1 UTSW 4 129742275 start gained probably benign
R6377:Khdrbs1 UTSW 4 129742097 missense probably damaging 0.98
R6983:Khdrbs1 UTSW 4 129720842 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCAGGTACTTATTCTCCGGCTC -3'
(R):5'- AACTGGGGACTTTGTTCTCCG -3'

Sequencing Primer
(F):5'- ATCTTGACCGCGGCTGTG -3'
(R):5'- CTCCGCGGAGAAACTCAAGG -3'
Posted On2015-07-07