Incidental Mutation 'R0013:Polq'
ID 32667
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 038308-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.509) question?
Stock # R0013 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 36832148-36915779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36882201 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1455 (F1455S)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect possibly damaging
Transcript: ENSMUST00000054034
AA Change: F1455S

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: F1455S

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071452
AA Change: F1176S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: F1176S

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182622
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,293,346 (GRCm39) M156V probably benign Het
Adnp2 A T 18: 80,172,960 (GRCm39) V483D probably damaging Het
Aff1 G T 5: 103,976,350 (GRCm39) E491* probably null Het
Agl A T 3: 116,570,257 (GRCm39) C911* probably null Het
Akt2 A G 7: 27,335,483 (GRCm39) D284G probably damaging Het
Alox15 A G 11: 70,240,461 (GRCm39) M240T possibly damaging Het
Antxr2 A G 5: 98,127,844 (GRCm39) V229A probably damaging Het
Arap2 G A 5: 62,840,827 (GRCm39) L680F probably damaging Het
Btaf1 A G 19: 36,935,773 (GRCm39) T188A probably benign Het
Btnl6 G A 17: 34,734,505 (GRCm39) Q86* probably null Het
C2cd3 T A 7: 100,065,269 (GRCm39) L685H probably damaging Het
Cdh23 T C 10: 60,248,952 (GRCm39) T878A possibly damaging Het
Clec4b2 T C 6: 123,179,108 (GRCm39) Y137H probably damaging Het
Dchs1 T A 7: 105,405,043 (GRCm39) T2500S possibly damaging Het
Def6 A G 17: 28,436,066 (GRCm39) Y75C probably damaging Het
Dhx33 A T 11: 70,884,461 (GRCm39) F448L probably damaging Het
Dner C T 1: 84,472,614 (GRCm39) probably benign Het
Dnmbp G A 19: 43,890,670 (GRCm39) P366S probably benign Het
Eif4g3 T C 4: 137,903,159 (GRCm39) C1160R possibly damaging Het
Elmod1 G A 9: 53,820,185 (GRCm39) probably benign Het
Faah C A 4: 115,861,588 (GRCm39) L305F probably damaging Het
Flt1 A G 5: 147,507,824 (GRCm39) probably benign Het
Fyco1 A T 9: 123,651,471 (GRCm39) N1196K probably benign Het
Galnt18 T C 7: 111,153,664 (GRCm39) N320S probably damaging Het
Garin3 A G 11: 46,297,631 (GRCm39) T312A unknown Het
Glp2r C A 11: 67,600,538 (GRCm39) G437V possibly damaging Het
Gm4884 T C 7: 40,693,716 (GRCm39) S562P probably damaging Het
Gm9936 A G 5: 114,995,408 (GRCm39) probably benign Het
Gpn2 C A 4: 133,312,103 (GRCm39) P112T probably damaging Het
Grm4 A G 17: 27,650,549 (GRCm39) Y816H probably benign Het
Helz2 A T 2: 180,882,752 (GRCm39) S14T probably benign Het
Htt T C 5: 34,977,448 (GRCm39) L778P probably benign Het
Il11ra1 T C 4: 41,765,060 (GRCm39) S129P probably damaging Het
Ints11 T C 4: 155,971,625 (GRCm39) F315S probably damaging Het
Itga11 A T 9: 62,683,895 (GRCm39) N1059Y possibly damaging Het
Jak3 A G 8: 72,136,971 (GRCm39) S716G probably damaging Het
Kcns1 G T 2: 164,010,563 (GRCm39) D65E probably benign Het
Kdm5d A T Y: 941,715 (GRCm39) K1305N probably benign Het
Kif26a G T 12: 112,144,314 (GRCm39) V1523L probably benign Het
Mboat7 A G 7: 3,686,821 (GRCm39) S340P probably damaging Het
Mctp2 T C 7: 71,879,156 (GRCm39) I234V probably benign Het
Mex3c G A 18: 73,723,622 (GRCm39) A572T probably benign Het
Mpp3 C A 11: 101,896,251 (GRCm39) R424L probably benign Het
Mroh4 T A 15: 74,480,086 (GRCm39) probably benign Het
Myo9a A T 9: 59,767,489 (GRCm39) probably benign Het
Myog T A 1: 134,217,973 (GRCm39) H60Q probably damaging Het
Nlrp9a T A 7: 26,270,650 (GRCm39) probably null Het
Notch1 A G 2: 26,363,830 (GRCm39) V868A possibly damaging Het
Or10g9b A T 9: 39,917,651 (GRCm39) I198N probably damaging Het
Or1j20 A G 2: 36,760,172 (GRCm39) N198S probably damaging Het
Or1p1 T A 11: 74,179,877 (GRCm39) I135N possibly damaging Het
Or5d18 T C 2: 87,864,610 (GRCm39) Y291C possibly damaging Het
Pink1 T C 4: 138,044,712 (GRCm39) T342A probably benign Het
Plb1 T A 5: 32,506,959 (GRCm39) probably benign Het
Plec T C 15: 76,062,446 (GRCm39) D2524G probably damaging Het
Plekhg4 G T 8: 106,102,028 (GRCm39) E6* probably null Het
Ppm1e A G 11: 87,139,884 (GRCm39) probably benign Het
Prkaca G A 8: 84,714,932 (GRCm39) M119I possibly damaging Het
Prss46 G T 9: 110,679,123 (GRCm39) S108I probably damaging Het
Ptma C T 1: 86,457,498 (GRCm39) probably benign Het
Rab11fip4 C T 11: 79,580,479 (GRCm39) T437M probably benign Het
Rngtt T A 4: 33,379,409 (GRCm39) M437K probably benign Het
Rrn3 T A 16: 13,630,977 (GRCm39) D604E possibly damaging Het
Scn4a A G 11: 106,239,231 (GRCm39) probably benign Het
Sis A G 3: 72,817,809 (GRCm39) L1468P possibly damaging Het
Slit3 A G 11: 35,598,745 (GRCm39) M1450V probably benign Het
Smg5 T C 3: 88,256,540 (GRCm39) S269P probably benign Het
Sntg1 T C 1: 8,533,686 (GRCm39) T323A probably damaging Het
Son C T 16: 91,448,550 (GRCm39) T37I probably damaging Het
Stk17b T C 1: 53,803,291 (GRCm39) I41M probably benign Het
Tgm5 T A 2: 120,907,363 (GRCm39) Y120F probably damaging Het
Tppp A G 13: 74,169,479 (GRCm39) K73R possibly damaging Het
Ttn C A 2: 76,569,502 (GRCm39) K27130N probably damaging Het
Ttn C T 2: 76,738,096 (GRCm39) V4148I probably benign Het
Tut4 T A 4: 108,388,152 (GRCm39) probably benign Het
Uba7 A T 9: 107,855,448 (GRCm39) Y375F probably damaging Het
Ugcg T C 4: 59,213,931 (GRCm39) L171P possibly damaging Het
Vsig2 T C 9: 37,453,872 (GRCm39) probably benign Het
Zfp839 T A 12: 110,834,820 (GRCm39) S692T possibly damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 36,885,609 (GRCm39) splice site probably benign
IGL00539:Polq APN 16 36,880,931 (GRCm39) missense probably damaging 0.98
IGL00960:Polq APN 16 36,880,874 (GRCm39) missense probably damaging 0.96
IGL01100:Polq APN 16 36,881,474 (GRCm39) missense probably benign
IGL01112:Polq APN 16 36,837,671 (GRCm39) missense probably damaging 1.00
IGL01138:Polq APN 16 36,866,231 (GRCm39) missense possibly damaging 0.94
IGL01432:Polq APN 16 36,892,184 (GRCm39) splice site probably benign
IGL01522:Polq APN 16 36,848,265 (GRCm39) missense probably damaging 1.00
IGL01565:Polq APN 16 36,833,475 (GRCm39) missense probably benign 0.00
IGL01592:Polq APN 16 36,855,212 (GRCm39) missense probably benign 0.01
IGL01690:Polq APN 16 36,883,200 (GRCm39) missense probably damaging 0.97
IGL01943:Polq APN 16 36,881,805 (GRCm39) missense possibly damaging 0.47
IGL02531:Polq APN 16 36,882,736 (GRCm39) missense possibly damaging 0.75
IGL02553:Polq APN 16 36,862,130 (GRCm39) missense probably damaging 1.00
IGL02623:Polq APN 16 36,880,737 (GRCm39) missense probably benign 0.04
IGL02692:Polq APN 16 36,880,989 (GRCm39) missense probably damaging 1.00
IGL02717:Polq APN 16 36,843,102 (GRCm39) missense probably damaging 1.00
IGL02937:Polq APN 16 36,833,471 (GRCm39) missense probably benign 0.14
IGL02959:Polq APN 16 36,906,928 (GRCm39) missense probably damaging 1.00
IGL03086:Polq APN 16 36,911,411 (GRCm39) missense probably benign 0.02
IGL03141:Polq APN 16 36,837,720 (GRCm39) splice site probably benign
IGL03302:Polq APN 16 36,892,134 (GRCm39) missense probably damaging 1.00
IGL03393:Polq APN 16 36,865,156 (GRCm39) missense probably damaging 1.00
R0013_Polq_667 UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280_polq_867 UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
G1Funyon:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
PIT4403001:Polq UTSW 16 36,880,949 (GRCm39) missense probably benign 0.00
R0082:Polq UTSW 16 36,837,619 (GRCm39) missense probably benign 0.01
R0212:Polq UTSW 16 36,887,216 (GRCm39) missense probably damaging 0.99
R0387:Polq UTSW 16 36,909,679 (GRCm39) missense probably damaging 1.00
R0387:Polq UTSW 16 36,849,792 (GRCm39) missense probably damaging 1.00
R0427:Polq UTSW 16 36,882,355 (GRCm39) nonsense probably null
R0454:Polq UTSW 16 36,855,252 (GRCm39) missense probably damaging 0.98
R0513:Polq UTSW 16 36,914,864 (GRCm39) missense probably damaging 1.00
R0622:Polq UTSW 16 36,881,355 (GRCm39) missense probably benign 0.02
R0848:Polq UTSW 16 36,882,492 (GRCm39) missense probably benign 0.08
R1142:Polq UTSW 16 36,833,579 (GRCm39) missense probably damaging 0.98
R1218:Polq UTSW 16 36,849,808 (GRCm39) missense possibly damaging 0.93
R1331:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R1398:Polq UTSW 16 36,882,857 (GRCm39) missense possibly damaging 0.87
R1424:Polq UTSW 16 36,906,890 (GRCm39) missense probably damaging 1.00
R1644:Polq UTSW 16 36,880,626 (GRCm39) missense probably damaging 0.96
R1777:Polq UTSW 16 36,880,586 (GRCm39) missense possibly damaging 0.94
R1820:Polq UTSW 16 36,849,780 (GRCm39) missense possibly damaging 0.48
R1854:Polq UTSW 16 36,882,471 (GRCm39) missense probably benign 0.01
R1880:Polq UTSW 16 36,906,954 (GRCm39) missense possibly damaging 0.90
R1932:Polq UTSW 16 36,882,666 (GRCm39) missense possibly damaging 0.92
R2008:Polq UTSW 16 36,882,844 (GRCm39) missense probably damaging 0.96
R2014:Polq UTSW 16 36,898,728 (GRCm39) missense probably damaging 1.00
R2026:Polq UTSW 16 36,883,107 (GRCm39) missense possibly damaging 0.93
R2178:Polq UTSW 16 36,883,191 (GRCm39) missense probably damaging 1.00
R2259:Polq UTSW 16 36,882,459 (GRCm39) missense probably benign 0.03
R2266:Polq UTSW 16 36,882,515 (GRCm39) missense possibly damaging 0.59
R2305:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R2370:Polq UTSW 16 36,894,301 (GRCm39) missense probably damaging 1.00
R2504:Polq UTSW 16 36,832,304 (GRCm39) missense unknown
R2517:Polq UTSW 16 36,909,687 (GRCm39) missense probably damaging 1.00
R2697:Polq UTSW 16 36,862,515 (GRCm39) missense probably damaging 1.00
R2858:Polq UTSW 16 36,883,115 (GRCm39) missense possibly damaging 0.88
R3436:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3437:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3699:Polq UTSW 16 36,862,518 (GRCm39) missense probably damaging 1.00
R3838:Polq UTSW 16 36,898,711 (GRCm39) missense probably damaging 1.00
R3875:Polq UTSW 16 36,894,389 (GRCm39) missense probably damaging 0.99
R4050:Polq UTSW 16 36,913,182 (GRCm39) critical splice acceptor site probably null
R4172:Polq UTSW 16 36,881,120 (GRCm39) missense probably benign 0.02
R4238:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4240:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280:Polq UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
R4296:Polq UTSW 16 36,881,663 (GRCm39) missense possibly damaging 0.94
R4360:Polq UTSW 16 36,880,701 (GRCm39) missense probably benign 0.00
R4373:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4375:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4376:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4509:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4510:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4511:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4543:Polq UTSW 16 36,881,147 (GRCm39) missense probably benign 0.43
R4633:Polq UTSW 16 36,868,904 (GRCm39) missense probably damaging 1.00
R4739:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R4834:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 1.00
R4841:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4842:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4937:Polq UTSW 16 36,848,274 (GRCm39) missense probably benign 0.01
R4955:Polq UTSW 16 36,881,444 (GRCm39) missense probably benign 0.32
R4992:Polq UTSW 16 36,881,524 (GRCm39) missense possibly damaging 0.59
R5008:Polq UTSW 16 36,882,749 (GRCm39) missense probably benign
R5221:Polq UTSW 16 36,862,540 (GRCm39) missense probably damaging 0.98
R5254:Polq UTSW 16 36,909,681 (GRCm39) missense probably damaging 1.00
R5292:Polq UTSW 16 36,881,745 (GRCm39) missense probably damaging 1.00
R5375:Polq UTSW 16 36,903,146 (GRCm39) missense probably damaging 1.00
R5480:Polq UTSW 16 36,833,652 (GRCm39) splice site probably benign
R5552:Polq UTSW 16 36,914,872 (GRCm39) missense possibly damaging 0.93
R5591:Polq UTSW 16 36,832,247 (GRCm39) utr 5 prime probably benign
R5653:Polq UTSW 16 36,860,896 (GRCm39) missense probably damaging 1.00
R5708:Polq UTSW 16 36,881,380 (GRCm39) missense probably damaging 0.98
R5754:Polq UTSW 16 36,837,625 (GRCm39) missense probably benign
R5757:Polq UTSW 16 36,907,043 (GRCm39) missense probably benign 0.01
R5764:Polq UTSW 16 36,837,706 (GRCm39) missense probably damaging 0.97
R6019:Polq UTSW 16 36,882,126 (GRCm39) missense probably damaging 1.00
R6170:Polq UTSW 16 36,866,174 (GRCm39) missense possibly damaging 0.82
R6177:Polq UTSW 16 36,892,071 (GRCm39) missense probably damaging 0.98
R6307:Polq UTSW 16 36,837,718 (GRCm39) critical splice donor site probably null
R6499:Polq UTSW 16 36,881,189 (GRCm39) missense probably benign 0.03
R6520:Polq UTSW 16 36,880,739 (GRCm39) missense possibly damaging 0.88
R6598:Polq UTSW 16 36,881,993 (GRCm39) missense probably benign 0.39
R6694:Polq UTSW 16 36,835,535 (GRCm39) missense probably null 0.99
R6788:Polq UTSW 16 36,897,510 (GRCm39) missense probably damaging 1.00
R7104:Polq UTSW 16 36,909,715 (GRCm39) nonsense probably null
R7159:Polq UTSW 16 36,883,215 (GRCm39) missense possibly damaging 0.87
R7222:Polq UTSW 16 36,906,995 (GRCm39) nonsense probably null
R7340:Polq UTSW 16 36,881,288 (GRCm39) missense probably benign 0.00
R7361:Polq UTSW 16 36,880,790 (GRCm39) missense probably benign 0.00
R7384:Polq UTSW 16 36,849,780 (GRCm39) missense probably damaging 1.00
R7509:Polq UTSW 16 36,880,706 (GRCm39) missense probably benign 0.00
R7509:Polq UTSW 16 36,880,705 (GRCm39) missense probably benign
R7575:Polq UTSW 16 36,911,496 (GRCm39) missense probably benign 0.00
R7785:Polq UTSW 16 36,848,239 (GRCm39) missense probably damaging 1.00
R7787:Polq UTSW 16 36,837,671 (GRCm39) missense probably damaging 1.00
R7891:Polq UTSW 16 36,848,244 (GRCm39) missense probably damaging 1.00
R7898:Polq UTSW 16 36,865,245 (GRCm39) missense probably damaging 0.98
R7917:Polq UTSW 16 36,885,650 (GRCm39) missense probably benign 0.08
R7940:Polq UTSW 16 36,881,004 (GRCm39) missense probably benign 0.27
R8028:Polq UTSW 16 36,881,678 (GRCm39) missense possibly damaging 0.82
R8114:Polq UTSW 16 36,862,577 (GRCm39) missense possibly damaging 0.94
R8144:Polq UTSW 16 36,849,846 (GRCm39) missense probably benign 0.01
R8288:Polq UTSW 16 36,848,272 (GRCm39) missense probably damaging 1.00
R8301:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
R8341:Polq UTSW 16 36,892,133 (GRCm39) missense possibly damaging 0.96
R8348:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8448:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8815:Polq UTSW 16 36,853,893 (GRCm39) missense probably damaging 1.00
R8843:Polq UTSW 16 36,832,280 (GRCm39) missense unknown
R8878:Polq UTSW 16 36,860,869 (GRCm39) missense probably benign 0.02
R9016:Polq UTSW 16 36,843,159 (GRCm39) missense probably damaging 1.00
R9189:Polq UTSW 16 36,865,265 (GRCm39) missense probably damaging 1.00
R9209:Polq UTSW 16 36,869,011 (GRCm39) missense possibly damaging 0.94
R9352:Polq UTSW 16 36,862,252 (GRCm39) missense probably damaging 0.98
R9398:Polq UTSW 16 36,881,394 (GRCm39) missense probably benign 0.02
R9403:Polq UTSW 16 36,882,215 (GRCm39) missense probably benign 0.00
R9489:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9605:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9664:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 0.98
R9801:Polq UTSW 16 36,913,190 (GRCm39) missense probably damaging 1.00
X0060:Polq UTSW 16 36,837,599 (GRCm39) nonsense probably null
Z1176:Polq UTSW 16 36,862,619 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTGAGTCTGTGAAAGCAAACACCG -3'
(R):5'- CAAACTCCTTGCTGCTGAGTACCC -3'

Sequencing Primer
(F):5'- TCAATAGAGGCGCTCCAGTC -3'
(R):5'- CTGAGGCTCACTCACAGTTGG -3'
Posted On 2013-05-09