Incidental Mutation 'R4402:Kdm7a'
ID326670
Institutional Source Beutler Lab
Gene Symbol Kdm7a
Ensembl Gene ENSMUSG00000042599
Gene Namelysine (K)-specific demethylase 7A
SynonymsKdm7a, Jhdm1d, ENSMUSG00000073143, A630082K20Rik
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location39136623-39206789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39166668 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 380 (R380W)
Ref Sequence ENSEMBL: ENSMUSP00000002305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002305]
Predicted Effect probably null
Transcript: ENSMUST00000002305
AA Change: R380W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002305
Gene: ENSMUSG00000042599
AA Change: R380W

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
PHD 39 86 8.64e-9 SMART
low complexity region 186 197 N/A INTRINSIC
JmjC 230 386 1.09e-49 SMART
low complexity region 408 419 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Meta Mutation Damage Score 0.8103 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicle, tail, sebaceous gland, rib, and vertebrae morphology and decreased circulating iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Kdm7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kdm7a APN 6 39144510 missense probably benign
IGL00976:Kdm7a APN 6 39144398 missense possibly damaging 0.90
IGL01063:Kdm7a APN 6 39165130 missense probably damaging 0.98
IGL01325:Kdm7a APN 6 39158309 splice site probably benign
IGL01710:Kdm7a APN 6 39175386 missense probably benign 0.06
IGL01953:Kdm7a APN 6 39146902 missense probably benign 0.10
IGL02336:Kdm7a APN 6 39170264 missense probably damaging 1.00
IGL02721:Kdm7a APN 6 39173437 missense possibly damaging 0.93
IGL02963:Kdm7a APN 6 39143230 missense probably damaging 1.00
IGL03165:Kdm7a APN 6 39170914 splice site probably benign
R0033:Kdm7a UTSW 6 39165197 nonsense probably null
R0831:Kdm7a UTSW 6 39166765 splice site probably benign
R0920:Kdm7a UTSW 6 39151322 missense probably damaging 1.00
R0962:Kdm7a UTSW 6 39147194 missense probably benign 0.05
R1403:Kdm7a UTSW 6 39151253 splice site probably benign
R1632:Kdm7a UTSW 6 39152898 missense probably benign 0.15
R1759:Kdm7a UTSW 6 39147699 splice site probably null
R2143:Kdm7a UTSW 6 39168950 missense possibly damaging 0.61
R2197:Kdm7a UTSW 6 39146936 missense probably damaging 0.98
R2496:Kdm7a UTSW 6 39170763 splice site probably null
R3844:Kdm7a UTSW 6 39181579 missense probably damaging 1.00
R4083:Kdm7a UTSW 6 39152814 missense probably damaging 1.00
R4184:Kdm7a UTSW 6 39148977 missense probably benign
R4193:Kdm7a UTSW 6 39169096 missense probably damaging 1.00
R4544:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4546:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4560:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4561:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4562:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4563:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4737:Kdm7a UTSW 6 39152839 missense possibly damaging 0.57
R5061:Kdm7a UTSW 6 39151452 missense possibly damaging 0.88
R5247:Kdm7a UTSW 6 39144456 missense probably benign 0.00
R5430:Kdm7a UTSW 6 39149342 missense possibly damaging 0.85
R6248:Kdm7a UTSW 6 39147049 missense possibly damaging 0.63
R6254:Kdm7a UTSW 6 39170269 missense probably damaging 1.00
R6346:Kdm7a UTSW 6 39151211 intron probably null
R6420:Kdm7a UTSW 6 39165168 missense probably damaging 1.00
R6908:Kdm7a UTSW 6 39144439 missense possibly damaging 0.79
R6966:Kdm7a UTSW 6 39152839 missense probably damaging 1.00
R7048:Kdm7a UTSW 6 39169048 missense probably damaging 1.00
R7087:Kdm7a UTSW 6 39175381 missense probably benign 0.18
R7450:Kdm7a UTSW 6 39143251 missense probably damaging 1.00
R7737:Kdm7a UTSW 6 39144404 missense probably benign 0.03
RF012:Kdm7a UTSW 6 39206513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTATCTCCACAGAATCTC -3'
(R):5'- GCCAGGGTATGAAGTTAATTGAC -3'

Sequencing Primer
(F):5'- GTCCTGGAACTTACTCTGTAGACCAG -3'
(R):5'- CAGGGTATGAAGTTAATTGACATTGG -3'
Posted On2015-07-07