Incidental Mutation 'R4402:2810021J22Rik'
ID326685
Institutional Source Beutler Lab
Gene Symbol 2810021J22Rik
Ensembl Gene ENSMUSG00000020491
Gene NameRIKEN cDNA 2810021J22 gene
Synonyms
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58867216-58883288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58880194 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 167 (H167Q)
Ref Sequence ENSEMBL: ENSMUSP00000073579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073924] [ENSMUST00000132570]
Predicted Effect probably benign
Transcript: ENSMUST00000073924
AA Change: H167Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000073579
Gene: ENSMUSG00000020491
AA Change: H167Q

DomainStartEndE-ValueType
KRAB 8 68 2.38e-30 SMART
ZnF_C2H2 242 264 1.68e1 SMART
ZnF_C2H2 370 392 1.56e-2 SMART
ZnF_C2H2 398 420 1.03e-2 SMART
ZnF_C2H2 426 448 1.38e-3 SMART
ZnF_C2H2 454 476 3.16e-3 SMART
ZnF_C2H2 482 504 1.6e-4 SMART
ZnF_C2H2 510 532 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132570
SMART Domains Protein: ENSMUSP00000120692
Gene: ENSMUSG00000020491

DomainStartEndE-ValueType
KRAB 8 64 2.25e-17 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in 2810021J22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:2810021J22Rik APN 11 58880612 nonsense probably null
IGL01784:2810021J22Rik APN 11 58880619 missense possibly damaging 0.89
IGL02287:2810021J22Rik APN 11 58880592 missense probably benign 0.00
IGL03281:2810021J22Rik APN 11 58880775 missense probably benign 0.01
H8562:2810021J22Rik UTSW 11 58880891 missense probably damaging 1.00
R0480:2810021J22Rik UTSW 11 58880186 missense probably damaging 0.99
R1148:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1148:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1493:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1565:2810021J22Rik UTSW 11 58880501 missense probably benign 0.00
R1676:2810021J22Rik UTSW 11 58880993 missense possibly damaging 0.70
R2070:2810021J22Rik UTSW 11 58876769 missense probably damaging 0.98
R2071:2810021J22Rik UTSW 11 58876769 missense probably damaging 0.98
R4541:2810021J22Rik UTSW 11 58878850 missense probably benign 0.16
R4685:2810021J22Rik UTSW 11 58880924 missense probably damaging 0.97
R4765:2810021J22Rik UTSW 11 58881161 missense probably benign 0.09
R4968:2810021J22Rik UTSW 11 58878790 nonsense probably null
R5282:2810021J22Rik UTSW 11 58880340 missense possibly damaging 0.84
R5519:2810021J22Rik UTSW 11 58880097 missense probably benign
R6083:2810021J22Rik UTSW 11 58878851 missense possibly damaging 0.73
R6134:2810021J22Rik UTSW 11 58876793 missense probably damaging 1.00
R6334:2810021J22Rik UTSW 11 58880114 missense probably benign
R7108:2810021J22Rik UTSW 11 58880924 missense probably damaging 0.97
R7288:2810021J22Rik UTSW 11 58880305 missense probably benign 0.03
R7310:2810021J22Rik UTSW 11 58880268 missense possibly damaging 0.89
R7422:2810021J22Rik UTSW 11 58881059 missense probably damaging 1.00
R7829:2810021J22Rik UTSW 11 58879997 missense not run
R8237:2810021J22Rik UTSW 11 58880547 missense probably damaging 1.00
R8303:2810021J22Rik UTSW 11 58880140 missense probably benign 0.00
Z1177:2810021J22Rik UTSW 11 58880103 missense probably damaging 0.99
Z1186:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1187:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1188:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1189:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1190:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1191:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Z1192:2810021J22Rik UTSW 11 58880535 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAACATTTGAGCCACCTGC -3'
(R):5'- GCCAACTTATCAAAGGCATTCG -3'

Sequencing Primer
(F):5'- TGCTAGTCACTGGCAGTGCATC -3'
(R):5'- CTTATCAAAGGCATTCGTCGAGCTG -3'
Posted On2015-07-07