Incidental Mutation 'R4402:Olfr385'
ID326687
Institutional Source Beutler Lab
Gene Symbol Olfr385
Ensembl Gene ENSMUSG00000095095
Gene Nameolfactory receptor 385
SynonymsMOR135-3, GA_x6K02T2P1NL-3760313-3759375
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73588302-73593008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73589255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 161 (V161A)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
Predicted Effect probably benign
Transcript: ENSMUST00000071553
AA Change: V161A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: V161A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215689
AA Change: V161A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Olfr385
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Olfr385 APN 11 73589383 missense probably benign 0.34
IGL02045:Olfr385 APN 11 73589232 missense probably damaging 1.00
IGL02324:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02328:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02562:Olfr385 APN 11 73589411 missense probably benign
IGL02715:Olfr385 APN 11 73589121 missense probably benign 0.00
IGL03182:Olfr385 APN 11 73589442 missense probably benign 0.04
IGL03048:Olfr385 UTSW 11 73589005 missense possibly damaging 0.56
R0346:Olfr385 UTSW 11 73589457 missense probably damaging 1.00
R0675:Olfr385 UTSW 11 73589252 missense probably damaging 1.00
R0751:Olfr385 UTSW 11 73589144 missense probably benign 0.02
R1220:Olfr385 UTSW 11 73589377 nonsense probably null
R1389:Olfr385 UTSW 11 73589543 missense possibly damaging 0.88
R1484:Olfr385 UTSW 11 73589361 missense possibly damaging 0.91
R1619:Olfr385 UTSW 11 73589292 missense probably damaging 1.00
R2290:Olfr385 UTSW 11 73588919 missense probably benign 0.37
R3713:Olfr385 UTSW 11 73588905 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589368 nonsense probably null
R3782:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3782:Olfr385 UTSW 11 73589368 nonsense probably null
R4721:Olfr385 UTSW 11 73589447 missense probably damaging 1.00
R5157:Olfr385 UTSW 11 73589723 missense probably damaging 1.00
R5995:Olfr385 UTSW 11 73589250 missense probably benign
R6373:Olfr385 UTSW 11 73588898 missense probably benign 0.42
R6658:Olfr385 UTSW 11 73589048 missense probably damaging 0.99
R7046:Olfr385 UTSW 11 73589732 missense probably benign
R7096:Olfr385 UTSW 11 73589637 missense probably benign 0.03
R7238:Olfr385 UTSW 11 73589735 start codon destroyed probably null 0.99
R7537:Olfr385 UTSW 11 73589268 missense probably benign 0.04
R7548:Olfr385 UTSW 11 73588976 missense possibly damaging 0.56
R7888:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
R7971:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCTATTCCCCGTGTAGATG -3'
(R):5'- CCAAGTTGCTGCAGAACATG -3'

Sequencing Primer
(F):5'- GGCTATTCCCCGTGTAGATGAAAAC -3'
(R):5'- GACACAACCATCTCCTATGTAGGTTG -3'
Posted On2015-07-07