Incidental Mutation 'R4402:Eif5'
ID326693
Institutional Source Beutler Lab
Gene Symbol Eif5
Ensembl Gene ENSMUSG00000021282
Gene Nameeukaryotic translation initiation factor 5
Synonyms2810011H21Rik, D12Ertd549e
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111538016-111546752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111541749 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 161 (K161N)
Ref Sequence ENSEMBL: ENSMUSP00000152221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050993] [ENSMUST00000166123] [ENSMUST00000220803] [ENSMUST00000221292] [ENSMUST00000222234] [ENSMUST00000222375] [ENSMUST00000222388] [ENSMUST00000222441] [ENSMUST00000222757]
Predicted Effect probably benign
Transcript: ENSMUST00000050993
AA Change: K161N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061616
Gene: ENSMUSG00000021282
AA Change: K161N

DomainStartEndE-ValueType
eIF2B_5 13 128 7.62e-67 SMART
low complexity region 154 171 N/A INTRINSIC
low complexity region 172 190 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
eIF5C 296 386 7.85e-40 SMART
low complexity region 421 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082559
Predicted Effect probably benign
Transcript: ENSMUST00000166123
AA Change: K161N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126825
Gene: ENSMUSG00000021282
AA Change: K161N

DomainStartEndE-ValueType
eIF2B_5 13 128 7.62e-67 SMART
low complexity region 154 171 N/A INTRINSIC
low complexity region 172 190 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
eIF5C 296 386 7.85e-40 SMART
low complexity region 421 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220918
Predicted Effect probably benign
Transcript: ENSMUST00000221101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221243
Predicted Effect probably benign
Transcript: ENSMUST00000221292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221872
Predicted Effect probably benign
Transcript: ENSMUST00000222234
Predicted Effect probably benign
Transcript: ENSMUST00000222375
AA Change: K161N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000222388
AA Change: K161N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000222441
Predicted Effect probably benign
Transcript: ENSMUST00000222757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223437
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor-5 (EIF5) interacts with the 40S initiation complex to promote hydrolysis of bound GTP with concomitant joining of the 60S ribosomal subunit to the 40S initiation complex. The resulting functional 80S ribosomal initiation complex is then active in peptidyl transfer and chain elongations (summary by Si et al., 1996 [PubMed 8663286]).[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Eif5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Eif5 APN 12 111540555 missense probably damaging 1.00
IGL03399:Eif5 APN 12 111544590 missense probably damaging 0.99
Builder UTSW 12 111543608 missense probably damaging 1.00
Karenina UTSW 12 111542793 missense probably benign 0.16
Tolstoy UTSW 12 111543555 missense probably damaging 1.00
R0561:Eif5 UTSW 12 111540516 missense probably benign 0.20
R1633:Eif5 UTSW 12 111540287 missense probably damaging 0.99
R1717:Eif5 UTSW 12 111542217 missense probably benign 0.00
R2939:Eif5 UTSW 12 111540279 missense probably damaging 1.00
R3820:Eif5 UTSW 12 111540184 nonsense probably null
R4532:Eif5 UTSW 12 111539884 nonsense probably null
R5040:Eif5 UTSW 12 111539850 missense probably damaging 0.99
R5379:Eif5 UTSW 12 111543555 missense probably damaging 1.00
R5575:Eif5 UTSW 12 111542306 missense probably damaging 0.98
R6278:Eif5 UTSW 12 111542793 missense probably benign 0.16
R6629:Eif5 UTSW 12 111543608 missense probably damaging 1.00
R7043:Eif5 UTSW 12 111544596 missense probably benign 0.13
R7347:Eif5 UTSW 12 111540290 utr 3 prime probably benign
R7409:Eif5 UTSW 12 111540263 utr 3 prime probably benign
R7513:Eif5 UTSW 12 111540252 missense probably damaging 0.97
X0013:Eif5 UTSW 12 111544594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCCATTCAGAATTCTAAATGTCG -3'
(R):5'- GTCAGTTTAGTTCAACTCAACCC -3'

Sequencing Primer
(F):5'- TCGTTTTGTTTTAATCATGTTGGC -3'
(R):5'- GCACACTGTTTTAATTAAGCGTTG -3'
Posted On2015-07-07