Incidental Mutation 'R4402:Piwil2'
ID326697
Institutional Source Beutler Lab
Gene Symbol Piwil2
Ensembl Gene ENSMUSG00000033644
Gene Namepiwi-like RNA-mediated gene silencing 2
SynonymsMiwi like, mili
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70372477-70429383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70408916 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 390 (D390E)
Ref Sequence ENSEMBL: ENSMUSP00000047385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048129] [ENSMUST00000226229]
PDB Structure
Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048129
AA Change: D390E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047385
Gene: ENSMUSG00000033644
AA Change: D390E

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
DUF1785 335 386 7.44e-2 SMART
PAZ 386 524 1.92e-62 SMART
Piwi 666 957 2.45e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226229
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testis weight, azoospermia, and male infertility associated with a complete arrest of spermatogenesis and increased apoptotic cell death during the early prophase of the first meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Piwil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Piwil2 APN 14 70398218 missense probably benign 0.35
IGL02215:Piwil2 APN 14 70391373 missense possibly damaging 0.50
IGL02427:Piwil2 APN 14 70398134 splice site probably benign
IGL02554:Piwil2 APN 14 70391486 splice site probably benign
R0257:Piwil2 UTSW 14 70422631 missense probably benign 0.00
R0566:Piwil2 UTSW 14 70410394 missense probably damaging 0.99
R0800:Piwil2 UTSW 14 70409037 unclassified probably benign
R0828:Piwil2 UTSW 14 70376017 missense probably damaging 1.00
R0862:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0864:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0881:Piwil2 UTSW 14 70408927 missense probably benign 0.34
R1734:Piwil2 UTSW 14 70426505 critical splice donor site probably null
R1997:Piwil2 UTSW 14 70426658 missense possibly damaging 0.90
R2011:Piwil2 UTSW 14 70426634 missense probably damaging 1.00
R2043:Piwil2 UTSW 14 70391470 missense probably benign 0.00
R2347:Piwil2 UTSW 14 70408917 missense probably damaging 0.98
R2998:Piwil2 UTSW 14 70411238 missense probably damaging 1.00
R4455:Piwil2 UTSW 14 70390565 missense probably benign 0.02
R4611:Piwil2 UTSW 14 70402197 missense probably benign 0.07
R4763:Piwil2 UTSW 14 70376778 missense probably damaging 1.00
R4869:Piwil2 UTSW 14 70395362 missense probably benign 0.00
R5033:Piwil2 UTSW 14 70421593 missense possibly damaging 0.71
R5207:Piwil2 UTSW 14 70392517 missense probably damaging 1.00
R5395:Piwil2 UTSW 14 70395397 missense probably benign 0.01
R5486:Piwil2 UTSW 14 70401431 missense probably benign 0.01
R5504:Piwil2 UTSW 14 70389899 missense probably benign 0.01
R5629:Piwil2 UTSW 14 70422967 missense probably damaging 1.00
R5967:Piwil2 UTSW 14 70390564 missense probably benign 0.00
R6167:Piwil2 UTSW 14 70422893 critical splice donor site probably null
R6168:Piwil2 UTSW 14 70395351 missense probably benign 0.04
R6517:Piwil2 UTSW 14 70374336 missense probably benign 0.44
R7261:Piwil2 UTSW 14 70374411 missense probably damaging 1.00
R7727:Piwil2 UTSW 14 70394057 missense probably damaging 1.00
R7745:Piwil2 UTSW 14 70394189 missense probably benign
X0023:Piwil2 UTSW 14 70398199 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTCTCTCAGCTCTCTGC -3'
(R):5'- CCTCATGATTATCAAGGAAGGGCAG -3'

Sequencing Primer
(F):5'- GCCTGGAACTCTATATAGCCTAGG -3'
(R):5'- AGGGCAGTGTCAGCATTG -3'
Posted On2015-07-07