Incidental Mutation 'R4402:Liph'
ID326700
Institutional Source Beutler Lab
Gene Symbol Liph
Ensembl Gene ENSMUSG00000044626
Gene Namelipase, member H
SynonymsD16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21953817-21995663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21976250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 204 (I204N)
Ref Sequence ENSEMBL: ENSMUSP00000156378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]
Predicted Effect probably damaging
Transcript: ENSMUST00000060673
AA Change: I204N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626
AA Change: I204N

DomainStartEndE-ValueType
Pfam:Lipase 11 326 6.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074230
AA Change: I204N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626
AA Change: I204N

DomainStartEndE-ValueType
Pfam:Lipase 15 214 1.5e-45 PFAM
Pfam:Abhydrolase_6 73 296 2.3e-6 PFAM
Pfam:Lipase 209 296 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231682
Predicted Effect probably damaging
Transcript: ENSMUST00000231766
AA Change: I204N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232673
Meta Mutation Damage Score 0.9585 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Liph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Liph APN 16 21968140 missense probably damaging 1.00
babyback UTSW 16 21983957 missense probably damaging 0.97
PIT4131001:Liph UTSW 16 21995369 start codon destroyed probably null 0.59
R0004:Liph UTSW 16 21984194 nonsense probably null
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0348:Liph UTSW 16 21967980 splice site probably null
R0689:Liph UTSW 16 21968068 missense probably damaging 1.00
R0715:Liph UTSW 16 21995350 missense probably benign 0.05
R1104:Liph UTSW 16 21984148 missense possibly damaging 0.82
R1779:Liph UTSW 16 21968050 missense probably benign 0.01
R2323:Liph UTSW 16 21984004 missense probably damaging 0.99
R3913:Liph UTSW 16 21962259 splice site probably benign
R4454:Liph UTSW 16 21984268 missense probably benign 0.11
R4672:Liph UTSW 16 21984056 missense probably benign 0.14
R4681:Liph UTSW 16 21984027 missense probably benign 0.02
R5111:Liph UTSW 16 21984070 missense probably damaging 1.00
R5135:Liph UTSW 16 21956165 nonsense probably null
R5235:Liph UTSW 16 21984035 missense probably damaging 1.00
R5642:Liph UTSW 16 21965995 missense possibly damaging 0.61
R5810:Liph UTSW 16 21968110 missense probably damaging 1.00
R6188:Liph UTSW 16 21984268 missense probably benign 0.11
R6557:Liph UTSW 16 21983920 missense possibly damaging 0.60
R6734:Liph UTSW 16 21983957 missense probably damaging 0.97
R7011:Liph UTSW 16 21984097 missense probably damaging 0.98
R7038:Liph UTSW 16 21976259 missense probably damaging 1.00
R7178:Liph UTSW 16 21976328 missense probably damaging 1.00
R7185:Liph UTSW 16 21995339 missense probably benign 0.00
R7198:Liph UTSW 16 21966022 missense probably damaging 1.00
R7775:Liph UTSW 16 21958914 missense probably damaging 1.00
R7832:Liph UTSW 16 21962236 missense probably benign 0.01
R7993:Liph UTSW 16 21958812 missense probably benign 0.03
R8264:Liph UTSW 16 21983971 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGGAGATCCACCAAAAGCC -3'
(R):5'- TGATGCTAGCGATTACTCACC -3'

Sequencing Primer
(F):5'- GCCAGGGGTGCTTTGAATCAC -3'
(R):5'- TAGCGATTACTCACCCAAGCATG -3'
Posted On2015-07-07