Incidental Mutation 'R4402:Zfp40'
ID326702
Institutional Source Beutler Lab
Gene Symbol Zfp40
Ensembl Gene ENSMUSG00000002617
Gene Namezinc finger protein 40
SynonymsNTfin12, Zfp-40
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23173869-23193252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23176719 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 230 (H230L)
Ref Sequence ENSEMBL: ENSMUSP00000121359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037057] [ENSMUST00000140313] [ENSMUST00000172177]
Predicted Effect probably benign
Transcript: ENSMUST00000037057
AA Change: H298L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039794
Gene: ENSMUSG00000002617
AA Change: H298L

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135840
Predicted Effect possibly damaging
Transcript: ENSMUST00000140313
AA Change: H230L

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121359
Gene: ENSMUSG00000002617
AA Change: H230L

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-16 BLAST
ZnF_C2H2 157 179 1.47e-3 SMART
ZnF_C2H2 213 234 5.77e0 SMART
ZnF_C2H2 240 262 4.34e0 SMART
ZnF_C2H2 268 290 1.82e-3 SMART
ZnF_C2H2 295 317 4.24e-4 SMART
ZnF_C2H2 323 345 2.75e-3 SMART
ZnF_C2H2 351 373 1.38e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 8.47e-4 SMART
ZnF_C2H2 463 485 2.57e-3 SMART
ZnF_C2H2 491 513 8.47e-4 SMART
ZnF_C2H2 519 541 4.54e-4 SMART
ZnF_C2H2 547 568 1.26e1 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 3.21e-4 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
ZnF_C2H2 658 680 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142999
Predicted Effect probably benign
Transcript: ENSMUST00000172177
AA Change: H298L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128758
Gene: ENSMUSG00000002617
AA Change: H298L

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Meta Mutation Damage Score 0.6859 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Rps6kc1 A G 1: 190,798,605 probably benign Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Zfp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Zfp40 APN 17 23175742 missense probably benign 0.18
IGL02664:Zfp40 APN 17 23176986 missense probably benign 0.14
IGL02729:Zfp40 APN 17 23178311 missense probably damaging 0.99
R1288:Zfp40 UTSW 17 23182162 missense probably benign 0.01
R1450:Zfp40 UTSW 17 23175258 missense probably benign 0.15
R1535:Zfp40 UTSW 17 23175869 missense probably damaging 1.00
R1655:Zfp40 UTSW 17 23177266 missense probably benign 0.01
R1797:Zfp40 UTSW 17 23175540 missense possibly damaging 0.93
R2254:Zfp40 UTSW 17 23178370 missense possibly damaging 0.92
R3764:Zfp40 UTSW 17 23177127 missense possibly damaging 0.49
R4356:Zfp40 UTSW 17 23177190 missense probably benign 0.15
R4781:Zfp40 UTSW 17 23175655 missense probably damaging 0.99
R4792:Zfp40 UTSW 17 23177034 missense possibly damaging 0.79
R6142:Zfp40 UTSW 17 23176337 missense probably benign 0.40
R6179:Zfp40 UTSW 17 23178380 missense possibly damaging 0.51
R6759:Zfp40 UTSW 17 23176536 missense possibly damaging 0.95
R7294:Zfp40 UTSW 17 23176437 missense possibly damaging 0.60
R7332:Zfp40 UTSW 17 23176181 nonsense probably null
R7386:Zfp40 UTSW 17 23177007 missense probably damaging 0.96
R7462:Zfp40 UTSW 17 23178388 missense possibly damaging 0.71
R7479:Zfp40 UTSW 17 23177318 missense probably benign 0.23
R7641:Zfp40 UTSW 17 23178283 missense possibly damaging 0.92
R7725:Zfp40 UTSW 17 23178277 missense probably benign 0.38
X0022:Zfp40 UTSW 17 23177154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTTGAAGACCTGAAGAGGAGG -3'
(R):5'- TTGTGTTCCATCATTGGCTCATA -3'

Sequencing Primer
(F):5'- GGAAAGGGATTTGCCACATTC -3'
(R):5'- TCAAGTCTCTATAGGCATCGGAG -3'
Posted On2015-07-07