Incidental Mutation 'R4403:Rcor3'
ID326714
Institutional Source Beutler Lab
Gene Symbol Rcor3
Ensembl Gene ENSMUSG00000037395
Gene NameREST corepressor 3
SynonymsE130101E15Rik, C730034D20Rik, 4921514E24Rik
MMRRC Submission 041687-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R4403 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location192098546-192138062 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 192119912 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000073279] [ENSMUST00000110849] [ENSMUST00000192128] [ENSMUST00000192128] [ENSMUST00000192158] [ENSMUST00000192222] [ENSMUST00000192491] [ENSMUST00000192491] [ENSMUST00000192866] [ENSMUST00000192866]
Predicted Effect probably null
Transcript: ENSMUST00000073279
SMART Domains Protein: ENSMUSP00000073004
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 349 363 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110849
SMART Domains Protein: ENSMUSP00000106473
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192128
SMART Domains Protein: ENSMUSP00000141637
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192128
SMART Domains Protein: ENSMUSP00000141637
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192158
SMART Domains Protein: ENSMUSP00000141841
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 98 6.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192222
Predicted Effect probably null
Transcript: ENSMUST00000192491
SMART Domains Protein: ENSMUSP00000141753
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192491
SMART Domains Protein: ENSMUSP00000141753
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192866
SMART Domains Protein: ENSMUSP00000142054
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192866
SMART Domains Protein: ENSMUSP00000142054
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194750
Predicted Effect probably null
Transcript: ENSMUST00000194750
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,436 Y2037C probably damaging Het
Adam33 T C 2: 131,053,270 T647A probably benign Het
Adamts9 C T 6: 92,859,864 A636T probably damaging Het
Aldh3b2 A T 19: 3,980,059 I348F probably damaging Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Btbd9 A G 17: 30,485,932 probably benign Het
C2cd3 A G 7: 100,432,099 R1361G probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Cbr2 T A 11: 120,730,802 N83I probably damaging Het
Crb1 T C 1: 139,248,379 N561S probably benign Het
Dpp6 T A 5: 27,718,462 L690Q probably damaging Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Enthd1 A G 15: 80,452,824 S470P probably benign Het
Fat3 T C 9: 15,944,873 Y3871C probably damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gosr1 T C 11: 76,754,735 E73G possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Kcnk15 A G 2: 163,858,618 N259S probably damaging Het
Kdm5d G T Y: 899,830 R132L probably damaging Het
Med21 C T 6: 146,649,182 R64* probably null Het
Mgea5 A T 19: 45,778,639 D99E probably damaging Het
Muc19 A T 15: 91,871,570 noncoding transcript Het
Nlrp4e T A 7: 23,321,463 C458* probably null Het
Obscn T C 11: 59,069,093 Q3525R possibly damaging Het
Phf3 A G 1: 30,804,409 L1823S probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Prmt3 T A 7: 49,780,357 H69Q probably damaging Het
Rhoa T A 9: 108,336,814 I192N probably benign Het
Sbf1 T C 15: 89,293,954 I1532V possibly damaging Het
Scn11a T C 9: 119,795,667 T530A probably damaging Het
Slc26a6 T C 9: 108,855,938 F39L probably benign Het
Tfpi A T 2: 84,444,862 M134K probably damaging Het
Other mutations in Rcor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Rcor3 APN 1 192127971 unclassified probably benign
IGL01688:Rcor3 APN 1 192123600 missense probably damaging 1.00
IGL01905:Rcor3 APN 1 192101002 missense probably damaging 1.00
R0523:Rcor3 UTSW 1 192130436 missense probably damaging 1.00
R1305:Rcor3 UTSW 1 192116346 missense possibly damaging 0.50
R1847:Rcor3 UTSW 1 192100833 missense possibly damaging 0.83
R1850:Rcor3 UTSW 1 192120111 missense probably benign
R3938:Rcor3 UTSW 1 192101085 missense possibly damaging 0.92
R4590:Rcor3 UTSW 1 192125917 missense probably damaging 1.00
R4750:Rcor3 UTSW 1 192130449 missense probably damaging 1.00
R5219:Rcor3 UTSW 1 192137513 utr 5 prime probably benign
R5617:Rcor3 UTSW 1 192120130 missense probably benign 0.09
R6059:Rcor3 UTSW 1 192119940 missense probably benign 0.21
R6156:Rcor3 UTSW 1 192127842 unclassified probably benign
R6250:Rcor3 UTSW 1 192100896 missense probably damaging 1.00
R6258:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6260:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6808:Rcor3 UTSW 1 192137882 missense possibly damaging 0.79
R7194:Rcor3 UTSW 1 192125961 missense possibly damaging 0.88
R7387:Rcor3 UTSW 1 192137524 start gained probably benign
R7402:Rcor3 UTSW 1 192127983 missense probably benign 0.00
R7407:Rcor3 UTSW 1 192101672 missense probably benign
R7432:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7451:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7452:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7570:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7571:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7572:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7718:Rcor3 UTSW 1 192101721 missense probably benign 0.00
R7729:Rcor3 UTSW 1 192101778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGTATCACATCTGACCATG -3'
(R):5'- GTTCTCTCAGGGTAACGCTGAC -3'

Sequencing Primer
(F):5'- TCACATCTGACCATGATGAGGTC -3'
(R):5'- AACCAGCAAGATCGGCCTGG -3'
Posted On2015-07-07