Incidental Mutation 'R0013:Adnp2'
ID32673
Institutional Source Beutler Lab
Gene Symbol Adnp2
Ensembl Gene ENSMUSG00000053950
Gene NameADNP homeobox 2
SynonymsZfp508, 8430420L05Rik
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80126311-80151482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80129745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 483 (V483D)
Ref Sequence ENSEMBL: ENSMUSP00000068560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066743]
Predicted Effect probably damaging
Transcript: ENSMUST00000066743
AA Change: V483D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068560
Gene: ENSMUSG00000053950
AA Change: V483D

DomainStartEndE-ValueType
ZnF_C2H2 73 96 4.57e0 SMART
ZnF_C2H2 106 128 1.06e2 SMART
ZnF_C2H2 155 178 5.48e0 SMART
ZnF_C2H2 215 240 7.29e0 SMART
low complexity region 277 290 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 333 355 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 625 648 N/A INTRINSIC
low complexity region 656 674 N/A INTRINSIC
ZnF_C2H2 696 718 9.96e0 SMART
ZnF_C2H2 724 746 4.99e1 SMART
low complexity region 747 761 N/A INTRINSIC
ZnF_C2H2 777 798 1.93e2 SMART
ZnF_C2H2 800 823 4.34e0 SMART
ZnF_C2H2 905 928 5.81e-2 SMART
HOX 1073 1135 3.25e-4 SMART
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Adnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Adnp2 APN 18 80128867 missense probably benign 0.00
IGL00730:Adnp2 APN 18 80128032 missense probably benign
IGL01615:Adnp2 APN 18 80128477 missense probably damaging 1.00
IGL01681:Adnp2 APN 18 80127888 missense probably damaging 1.00
IGL02549:Adnp2 APN 18 80129118 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0325:Adnp2 UTSW 18 80130653 missense probably benign 0.06
R0478:Adnp2 UTSW 18 80129334 missense probably benign 0.31
R0545:Adnp2 UTSW 18 80129401 missense probably benign 0.31
R0788:Adnp2 UTSW 18 80130004 missense probably benign
R1756:Adnp2 UTSW 18 80127697 makesense probably null
R2043:Adnp2 UTSW 18 80128326 missense probably damaging 1.00
R2121:Adnp2 UTSW 18 80129170 missense probably benign 0.00
R2260:Adnp2 UTSW 18 80128449 missense probably benign 0.01
R2374:Adnp2 UTSW 18 80130987 missense probably damaging 1.00
R3416:Adnp2 UTSW 18 80128158 missense possibly damaging 0.55
R3607:Adnp2 UTSW 18 80129069 missense probably damaging 1.00
R4012:Adnp2 UTSW 18 80130821 missense probably benign 0.01
R4260:Adnp2 UTSW 18 80137527 missense possibly damaging 0.85
R4588:Adnp2 UTSW 18 80128648 missense probably benign 0.22
R5158:Adnp2 UTSW 18 80137543 missense probably damaging 0.99
R5652:Adnp2 UTSW 18 80130850 missense probably damaging 1.00
R5717:Adnp2 UTSW 18 80128264 missense probably benign 0.13
R6743:Adnp2 UTSW 18 80128059 missense probably benign 0.00
R6786:Adnp2 UTSW 18 80129745 missense probably benign 0.03
R6903:Adnp2 UTSW 18 80130090 missense probably benign
R7105:Adnp2 UTSW 18 80128151 missense possibly damaging 0.94
R7507:Adnp2 UTSW 18 80130853 missense probably benign 0.22
R7620:Adnp2 UTSW 18 80130487 missense probably damaging 1.00
R7914:Adnp2 UTSW 18 80130841 missense probably damaging 0.96
R7991:Adnp2 UTSW 18 80129322 missense probably damaging 0.97
R8290:Adnp2 UTSW 18 80142733 missense probably damaging 1.00
R8366:Adnp2 UTSW 18 80130510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAAGAACGCCAGAGTTTACACC -3'
(R):5'- ATGTGCTCCGTGAACCAAGCTGTC -3'

Sequencing Primer
(F):5'- TTTACACCCTGATTCACAGGGAC -3'
(R):5'- GCCCATGAACAGACCTGTG -3'
Posted On2013-05-09