Mutagenetix > Incidental Mutation

Incidental Mutation 'R4403:Ap3b1'

326736

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

AP-3, Hps2, beta3A, rim2, recombination induced mutation 2

MMRRC Submission

041687-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.296) question?

Stock #

R4403 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94495468-94702825 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 94554607 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 248 (L248I)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022196
AA Change: L248I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: L248I

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Meta Mutation Damage Score

0.3531

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,306,595 (GRCm39)	Y2037C	probably damaging	Het
Adam33	T	C	2: 130,895,190 (GRCm39)	T647A	probably benign	Het
Adamts9	C	T	6: 92,836,845 (GRCm39)	A636T	probably damaging	Het
Aldh3b2	A	T	19: 4,030,059 (GRCm39)	I348F	probably damaging	Het
Btbd9	A	G	17: 30,704,906 (GRCm39)		probably benign	Het
C2cd3	A	G	7: 100,081,306 (GRCm39)	R1361G	probably damaging	Het
Cage1	T	A	13: 38,207,078 (GRCm39)	I256F	probably damaging	Het
Calcr	A	T	6: 3,708,484 (GRCm39)		probably null	Het
Cbr2	T	A	11: 120,621,628 (GRCm39)	N83I	probably damaging	Het
Crb1	T	C	1: 139,176,117 (GRCm39)	N561S	probably benign	Het
Dpp6	T	A	5: 27,923,460 (GRCm39)	L690Q	probably damaging	Het
Eef1d	C	T	15: 75,774,769 (GRCm39)	V213I	probably benign	Het
Enthd1	A	G	15: 80,337,025 (GRCm39)	S470P	probably benign	Het
Fat3	T	C	9: 15,856,169 (GRCm39)	Y3871C	probably damaging	Het
Fras1	C	A	5: 96,790,479 (GRCm39)	T951K	probably damaging	Het
Gosr1	T	C	11: 76,645,561 (GRCm39)	E73G	possibly damaging	Het
Il11	T	C	7: 4,778,995 (GRCm39)	Y45C	probably damaging	Het
Kcnk15	A	G	2: 163,700,538 (GRCm39)	N259S	probably damaging	Het
Kdm5d	G	T	Y: 899,830 (GRCm39)	R132L	probably damaging	Het
Med21	C	T	6: 146,550,680 (GRCm39)	R64*	probably null	Het
Muc19	A	T	15: 91,755,768 (GRCm39)		noncoding transcript	Het
Nlrp4e	T	A	7: 23,020,888 (GRCm39)	C458*	probably null	Het
Obscn	T	C	11: 58,959,919 (GRCm39)	Q3525R	possibly damaging	Het
Oga	A	T	19: 45,767,078 (GRCm39)	D99E	probably damaging	Het
Phf3	A	G	1: 30,843,490 (GRCm39)	L1823S	probably damaging	Het
Pla2g1b	T	A	5: 115,608,947 (GRCm39)	Y47*	probably null	Het
Prmt3	T	A	7: 49,430,105 (GRCm39)	H69Q	probably damaging	Het
Rcor3	T	C	1: 191,804,212 (GRCm39)		probably null	Het
Rhoa	T	A	9: 108,214,013 (GRCm39)	I192N	probably benign	Het
Sbf1	T	C	15: 89,178,157 (GRCm39)	I1532V	possibly damaging	Het
Scn11a	T	C	9: 119,624,733 (GRCm39)	T530A	probably damaging	Het
Slc26a6	T	C	9: 108,733,137 (GRCm39)	F39L	probably benign	Het
Tfpi	A	T	2: 84,275,206 (GRCm39)	M134K	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94,527,371 (GRCm39)	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94,679,392 (GRCm39)	splice site	probably benign
IGL01784:Ap3b1	APN	13	94,630,247 (GRCm39)	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94,584,971 (GRCm39)	nonsense	probably null
IGL02040:Ap3b1	APN	13	94,545,353 (GRCm39)	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94,598,911 (GRCm39)	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94,531,303 (GRCm39)	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94,664,827 (GRCm39)	missense	unknown
IGL02493:Ap3b1	APN	13	94,540,528 (GRCm39)	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94,554,599 (GRCm39)	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94,613,529 (GRCm39)	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94,664,835 (GRCm39)	missense	unknown
IGL03033:Ap3b1	APN	13	94,585,003 (GRCm39)	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94,591,906 (GRCm39)	missense	probably benign	0.00
bella	UTSW	13	94,664,765 (GRCm39)	missense	unknown
bullet_gray	UTSW	13	94,587,594 (GRCm39)	critical splice donor site	probably benign
cuttlefish	UTSW	13	94,584,959 (GRCm39)	critical splice acceptor site	probably null
Gastropod	UTSW	13	94,679,348 (GRCm39)	missense	unknown
razor	UTSW	13	94,630,239 (GRCm39)	missense	unknown
Slime	UTSW	13	94,540,586 (GRCm39)	missense	possibly damaging	0.51
slug	UTSW	13	94,545,353 (GRCm39)	critical splice donor site	probably null
snail	UTSW	13	94,616,393 (GRCm39)	splice site	probably benign
stalk	UTSW	13	94,609,439 (GRCm39)	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94,616,393 (GRCm39)	splice site	probably benign
R0265:Ap3b1	UTSW	13	94,630,189 (GRCm39)	missense	unknown
R0270:Ap3b1	UTSW	13	94,540,626 (GRCm39)	splice site	probably benign
R0346:Ap3b1	UTSW	13	94,582,479 (GRCm39)	nonsense	probably null
R0422:Ap3b1	UTSW	13	94,598,968 (GRCm39)	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94,609,446 (GRCm39)	splice site	probably benign
R0508:Ap3b1	UTSW	13	94,702,222 (GRCm39)	missense	unknown
R0764:Ap3b1	UTSW	13	94,616,387 (GRCm39)	splice site	probably benign
R1506:Ap3b1	UTSW	13	94,582,651 (GRCm39)	splice site	probably benign
R1593:Ap3b1	UTSW	13	94,638,435 (GRCm39)	missense	unknown
R1660:Ap3b1	UTSW	13	94,545,320 (GRCm39)	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94,630,225 (GRCm39)	missense	unknown
R1791:Ap3b1	UTSW	13	94,545,305 (GRCm39)	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94,608,212 (GRCm39)	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94,664,724 (GRCm39)	missense	unknown
R3031:Ap3b1	UTSW	13	94,702,151 (GRCm39)	missense	unknown
R3037:Ap3b1	UTSW	13	94,582,486 (GRCm39)	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94,554,607 (GRCm39)	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94,554,607 (GRCm39)	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94,702,243 (GRCm39)	missense	unknown
R4624:Ap3b1	UTSW	13	94,619,734 (GRCm39)	missense	unknown
R4626:Ap3b1	UTSW	13	94,540,586 (GRCm39)	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94,540,468 (GRCm39)	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94,702,149 (GRCm39)	missense	unknown
R4847:Ap3b1	UTSW	13	94,608,287 (GRCm39)	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94,609,313 (GRCm39)	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94,616,357 (GRCm39)	missense	unknown
R5628:Ap3b1	UTSW	13	94,613,556 (GRCm39)	missense	unknown
R5671:Ap3b1	UTSW	13	94,664,765 (GRCm39)	missense	unknown
R5677:Ap3b1	UTSW	13	94,664,704 (GRCm39)	missense	unknown
R5862:Ap3b1	UTSW	13	94,684,278 (GRCm39)	missense	unknown
R5941:Ap3b1	UTSW	13	94,619,773 (GRCm39)	missense	probably damaging	0.96
R5941:Ap3b1	UTSW	13	94,576,781 (GRCm39)	missense	probably benign	0.02
R6043:Ap3b1	UTSW	13	94,613,501 (GRCm39)	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94,630,207 (GRCm39)	missense	unknown
R6212:Ap3b1	UTSW	13	94,587,581 (GRCm39)	missense	probably damaging	1.00
R6301:Ap3b1	UTSW	13	94,664,803 (GRCm39)	missense	unknown
R6765:Ap3b1	UTSW	13	94,599,017 (GRCm39)	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94,616,369 (GRCm39)	missense	unknown
R6888:Ap3b1	UTSW	13	94,545,299 (GRCm39)	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94,554,650 (GRCm39)	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94,668,542 (GRCm39)	nonsense	probably null
R7422:Ap3b1	UTSW	13	94,664,673 (GRCm39)	missense	unknown
R7642:Ap3b1	UTSW	13	94,613,540 (GRCm39)	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94,587,581 (GRCm39)	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94,664,666 (GRCm39)	splice site	probably null
R7867:Ap3b1	UTSW	13	94,619,771 (GRCm39)	missense	unknown
R8492:Ap3b1	UTSW	13	94,531,294 (GRCm39)	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94,545,353 (GRCm39)	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94,664,725 (GRCm39)	missense	unknown
R8876:Ap3b1	UTSW	13	94,540,586 (GRCm39)	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94,679,348 (GRCm39)	missense	unknown
R8892:Ap3b1	UTSW	13	94,679,348 (GRCm39)	missense	unknown
R9065:Ap3b1	UTSW	13	94,608,223 (GRCm39)	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94,630,239 (GRCm39)	missense	unknown
R9152:Ap3b1	UTSW	13	94,609,439 (GRCm39)	critical splice donor site	probably null
R9166:Ap3b1	UTSW	13	94,608,236 (GRCm39)	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94,584,959 (GRCm39)	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94,540,570 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTGTGCTAGCTGACTAGG -3'
(R):5'- CAGTCACTGTCAAAACACTTGTC -3'

Sequencing Primer
(F):5'- CTGACTAGGAGGTTAGGTGAATAC -3'
(R):5'- CTTGTCAATCACAAAAATGAGTTCCC -3'

Posted On

2015-07-07