Incidental Mutation 'R0013:Dnmbp'
ID32674
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Namedynamin binding protein
Synonyms2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0013 (G1)
Quality Score176
Status Validated
Chromosome19
Chromosomal Location43846821-43940191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43902231 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 366 (P366S)
Ref Sequence ENSEMBL: ENSMUSP00000148708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212396]
Predicted Effect probably benign
Transcript: ENSMUST00000026209
AA Change: P366S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: P366S

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212032
AA Change: P366S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000212396
AA Change: P366S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCTGAGGCTGGGAAGAAACACC -3'
(R):5'- TCTACAGATTCCAAGCCCTGGAGAC -3'

Sequencing Primer
(F):5'- AGAAACACCGTTGACTTCCTCTG -3'
(R):5'- TGTGAAGTTATGTCCTAGCAACAGG -3'
Posted On2013-05-09