Incidental Mutation 'R4403:Aldh3b2'
ID 326742
Institutional Source Beutler Lab
Gene Symbol Aldh3b2
Ensembl Gene ENSMUSG00000075296
Gene Name aldehyde dehydrogenase 3 family, member B2
Synonyms
MMRRC Submission 041687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4403 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 3972328-3981645 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3980059 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 348 (I348F)
Ref Sequence ENSEMBL: ENSMUSP00000115356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143380]
AlphaFold E9Q3E1
Predicted Effect probably damaging
Transcript: ENSMUST00000143380
AA Change: I348F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115356
Gene: ENSMUSG00000075296
AA Change: I348F

DomainStartEndE-ValueType
Pfam:Aldedh 6 441 1.2e-87 PFAM
Meta Mutation Damage Score 0.7689 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,436 Y2037C probably damaging Het
Adam33 T C 2: 131,053,270 T647A probably benign Het
Adamts9 C T 6: 92,859,864 A636T probably damaging Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Btbd9 A G 17: 30,485,932 probably benign Het
C2cd3 A G 7: 100,432,099 R1361G probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Cbr2 T A 11: 120,730,802 N83I probably damaging Het
Crb1 T C 1: 139,248,379 N561S probably benign Het
Dpp6 T A 5: 27,718,462 L690Q probably damaging Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Enthd1 A G 15: 80,452,824 S470P probably benign Het
Fat3 T C 9: 15,944,873 Y3871C probably damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gosr1 T C 11: 76,754,735 E73G possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Kcnk15 A G 2: 163,858,618 N259S probably damaging Het
Kdm5d G T Y: 899,830 R132L probably damaging Het
Med21 C T 6: 146,649,182 R64* probably null Het
Mgea5 A T 19: 45,778,639 D99E probably damaging Het
Muc19 A T 15: 91,871,570 noncoding transcript Het
Nlrp4e T A 7: 23,321,463 C458* probably null Het
Obscn T C 11: 59,069,093 Q3525R possibly damaging Het
Phf3 A G 1: 30,804,409 L1823S probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Prmt3 T A 7: 49,780,357 H69Q probably damaging Het
Rcor3 T C 1: 192,119,912 probably null Het
Rhoa T A 9: 108,336,814 I192N probably benign Het
Sbf1 T C 15: 89,293,954 I1532V possibly damaging Het
Scn11a T C 9: 119,795,667 T530A probably damaging Het
Slc26a6 T C 9: 108,855,938 F39L probably benign Het
Tfpi A T 2: 84,444,862 M134K probably damaging Het
Other mutations in Aldh3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Aldh3b2 APN 19 3980083 missense probably benign 0.32
R0242:Aldh3b2 UTSW 19 3979414 nonsense probably null
R0242:Aldh3b2 UTSW 19 3979414 nonsense probably null
R0742:Aldh3b2 UTSW 19 3981034 missense probably damaging 1.00
R0924:Aldh3b2 UTSW 19 3979350 missense probably benign 0.09
R1531:Aldh3b2 UTSW 19 3977543 missense probably damaging 1.00
R1748:Aldh3b2 UTSW 19 3977572 missense probably damaging 0.99
R1899:Aldh3b2 UTSW 19 3978662 missense possibly damaging 0.55
R1968:Aldh3b2 UTSW 19 3980705 missense probably benign 0.22
R2228:Aldh3b2 UTSW 19 3981133 missense probably benign 0.00
R4282:Aldh3b2 UTSW 19 3977636 missense probably benign 0.03
R4717:Aldh3b2 UTSW 19 3981128 missense probably damaging 1.00
R4865:Aldh3b2 UTSW 19 3978469 missense probably damaging 1.00
R5093:Aldh3b2 UTSW 19 3979433 missense probably benign 0.00
R7035:Aldh3b2 UTSW 19 3978142 missense probably benign 0.23
R7223:Aldh3b2 UTSW 19 3979592 missense probably damaging 0.98
R8076:Aldh3b2 UTSW 19 3978859 missense possibly damaging 0.60
R8101:Aldh3b2 UTSW 19 3978134 missense probably benign 0.33
R8394:Aldh3b2 UTSW 19 3979461 missense probably benign 0.07
R8701:Aldh3b2 UTSW 19 3978448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTAGACTCACTGAGCTGG -3'
(R):5'- TGGATGTGACCAGTCTGTCC -3'

Sequencing Primer
(F):5'- TTCCATTGTCCCAGGAGGTCAG -3'
(R):5'- ATGTGACCAGTCTGTCCCCTTTTC -3'
Posted On 2015-07-07