Incidental Mutation 'R0013:Kdm5d'
Institutional Source Beutler Lab
Gene Symbol Kdm5d
Ensembl Gene ENSMUSG00000056673
Gene Namelysine (K)-specific demethylase 5D
SynonymsJarid1d, Smcy, HY
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosomal Location897788-956786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 941715 bp
Amino Acid Change Lysine to Asparagine at position 1305 (K1305N)
Ref Sequence ENSEMBL: ENSMUSP00000061095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055032] [ENSMUST00000186696] [ENSMUST00000186726]
Predicted Effect probably benign
Transcript: ENSMUST00000055032
AA Change: K1305N

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000061095
Gene: ENSMUSG00000056673
AA Change: K1305N

JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
Pfam:zf-C5HC2 706 758 5.2e-18 PFAM
Pfam:PLU-1 771 1096 1.4e-89 PFAM
low complexity region 1147 1156 N/A INTRINSIC
low complexity region 1164 1181 N/A INTRINSIC
PHD 1182 1243 2.54e-6 SMART
coiled coil region 1290 1318 N/A INTRINSIC
low complexity region 1340 1351 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1453 1459 N/A INTRINSIC
low complexity region 1525 1541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186696
SMART Domains Protein: ENSMUSP00000140663
Gene: ENSMUSG00000056673

JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
low complexity region 675 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186726
SMART Domains Protein: ENSMUSP00000140462
Gene: ENSMUSG00000056673

JmjN 13 54 1.4e-25 SMART
ARID 76 165 3.8e-40 SMART
BRIGHT 80 170 2.3e-40 SMART
Blast:ARID 175 260 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189955
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc finger domains. A short peptide derived from this protein is a minor histocompatibility antigen which can lead to graft rejection of male donor cells in a female recipient. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Kdm5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0426:Kdm5d UTSW Y 942437 splice site probably benign
R0486:Kdm5d UTSW Y 927107 missense probably damaging 1.00
R0620:Kdm5d UTSW Y 927330 missense probably damaging 0.98
R0781:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1015:Kdm5d UTSW Y 941687 missense possibly damaging 0.95
R1110:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1163:Kdm5d UTSW Y 898029 missense probably benign 0.18
R1203:Kdm5d UTSW Y 941011 missense probably damaging 1.00
R1238:Kdm5d UTSW Y 941282 missense probably damaging 1.00
R1723:Kdm5d UTSW Y 927753 missense probably damaging 1.00
R1842:Kdm5d UTSW Y 927798 missense probably damaging 1.00
R1885:Kdm5d UTSW Y 940781 splice site probably null
R2131:Kdm5d UTSW Y 941483 missense probably benign 0.02
R2571:Kdm5d UTSW Y 940932 missense probably benign 0.11
R2931:Kdm5d UTSW Y 942992 missense probably benign 0.18
R3123:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R3919:Kdm5d UTSW Y 939914 missense probably damaging 1.00
R4018:Kdm5d UTSW Y 910441 splice site probably benign
R4031:Kdm5d UTSW Y 916910 missense probably damaging 1.00
R4403:Kdm5d UTSW Y 899830 missense probably damaging 1.00
R4571:Kdm5d UTSW Y 927110 missense probably damaging 1.00
R4583:Kdm5d UTSW Y 914134 missense probably damaging 1.00
R4962:Kdm5d UTSW Y 940624 missense probably damaging 1.00
R5105:Kdm5d UTSW Y 941752 missense probably benign 0.00
R5249:Kdm5d UTSW Y 916692 missense probably damaging 1.00
R5367:Kdm5d UTSW Y 941645 missense probably benign 0.05
R5373:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5374:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5876:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R5909:Kdm5d UTSW Y 941306 missense probably benign 0.01
R6014:Kdm5d UTSW Y 921528 missense probably benign 0.45
R6109:Kdm5d UTSW Y 921501 missense probably damaging 1.00
R6251:Kdm5d UTSW Y 921693 missense probably damaging 1.00
R6349:Kdm5d UTSW Y 916847 missense probably damaging 0.99
R6450:Kdm5d UTSW Y 927056 missense probably damaging 1.00
R6595:Kdm5d UTSW Y 939829 missense probably benign
R6628:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R6745:Kdm5d UTSW Y 927112 missense probably benign 0.28
R6867:Kdm5d UTSW Y 927425 missense probably benign
R6963:Kdm5d UTSW Y 937975 missense probably benign 0.01
R7163:Kdm5d UTSW Y 899940 missense probably damaging 1.00
R7374:Kdm5d UTSW Y 941491 missense probably benign 0.41
R7483:Kdm5d UTSW Y 914044 missense possibly damaging 0.50
R7501:Kdm5d UTSW Y 941488 missense probably damaging 1.00
R7815:Kdm5d UTSW Y 940702 missense probably damaging 1.00
R7835:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R8057:Kdm5d UTSW Y 927355 missense possibly damaging 0.48
R8080:Kdm5d UTSW Y 910742 missense probably benign 0.01
R8130:Kdm5d UTSW Y 940658 missense possibly damaging 0.75
R8213:Kdm5d UTSW Y 941515 missense probably damaging 1.00
R8261:Kdm5d UTSW Y 936929 missense probably damaging 0.99
R8344:Kdm5d UTSW Y 942477 missense probably benign 0.05
R8348:Kdm5d UTSW Y 914056 missense probably benign 0.00
R8445:Kdm5d UTSW Y 916874 missense probably damaging 1.00
R8448:Kdm5d UTSW Y 914056 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- caaccttcctaatgctgtaacc -3'
Posted On2013-05-09