Incidental Mutation 'R4404:Pifo'
ID326751
Institutional Source Beutler Lab
Gene Symbol Pifo
Ensembl Gene ENSMUSG00000010136
Gene Nameprimary cilia formation
Synonymspitchfork, 1700027A23Rik
MMRRC Submission 041133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4404 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105996957-106014646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106001368 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 7 (P7L)
Ref Sequence ENSEMBL: ENSMUSP00000069454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010280] [ENSMUST00000066319]
Predicted Effect probably benign
Transcript: ENSMUST00000010280
SMART Domains Protein: ENSMUSP00000010280
Gene: ENSMUSG00000010136

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 183 209 5.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066319
AA Change: P7L

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069454
Gene: ENSMUSG00000010136
AA Change: P7L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 58 96 1.9e-2 PFAM
Pfam:SHIPPO-rpt 144 184 1.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198855
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Heterozygous null embryos generated by tetraploid complementation display embryonic lethality with double outlet heart right ventricle, duplicated cilia and defects in cilia disassembly. A conditional allele activated in limb bub cultures doesn't interfere with cilia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C87414 T A 5: 93,637,713 H236L possibly damaging Het
Ccdc188 A G 16: 18,218,420 Q153R probably damaging Het
Dopey1 T A 9: 86,522,813 L1721* probably null Het
Fer A T 17: 63,941,289 probably null Het
Fuk T A 8: 110,890,301 T406S probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Gria4 A T 9: 4,464,489 probably null Het
Gtf3c4 T C 2: 28,826,749 D813G probably damaging Het
Hars2 G T 18: 36,785,936 C83F probably damaging Het
Htr6 A G 4: 139,062,202 S251P probably benign Het
Igsf10 T C 3: 59,329,551 T1070A probably benign Het
Il22ra1 A T 4: 135,737,431 E149D possibly damaging Het
Lama3 G A 18: 12,582,531 M1681I probably benign Het
Loxhd1 G A 18: 77,431,132 G1878D probably damaging Het
Mcc G A 18: 44,759,298 T83M probably benign Het
Nol11 A T 11: 107,173,725 C468S probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Npy5r C T 8: 66,681,992 V50I probably benign Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Pam T C 1: 97,854,721 probably benign Het
Pank4 C T 4: 154,980,156 T724I probably benign Het
Sertm1 C T 3: 54,899,325 C93Y probably damaging Het
Slc22a2 A G 17: 12,614,764 T444A probably damaging Het
Trpm7 C A 2: 126,833,715 L489F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn2r76 T C 7: 86,228,303 T511A probably benign Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Pifo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pifo APN 3 106014508 missense probably benign 0.29
IGL01615:Pifo APN 3 105997207 splice site probably null
IGL02451:Pifo APN 3 106014504 missense probably benign 0.09
R0139:Pifo UTSW 3 105999570 missense possibly damaging 0.46
R1802:Pifo UTSW 3 106014550 missense possibly damaging 0.77
R1832:Pifo UTSW 3 106014596 missense possibly damaging 0.53
R4681:Pifo UTSW 3 105998385 missense probably damaging 1.00
R4984:Pifo UTSW 3 106001494 start gained probably benign
R5245:Pifo UTSW 3 106014454 missense possibly damaging 0.92
R5308:Pifo UTSW 3 106001103 missense probably benign 0.02
R6015:Pifo UTSW 3 105999621 missense possibly damaging 0.47
R7430:Pifo UTSW 3 106014518 missense probably benign
R8253:Pifo UTSW 3 105998367 missense probably benign
Z1177:Pifo UTSW 3 105999605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTTTCCTCGCTTGACG -3'
(R):5'- CCTCAAAGCTTAGATGTAACTTGACC -3'

Sequencing Primer
(F):5'- CGCTTGACGTGTTCCAAAG -3'
(R):5'- AGATGTAACTTGACCTGTGTCC -3'
Posted On2015-07-07