Incidental Mutation 'R4404:C87414'
ID326756
Institutional Source Beutler Lab
Gene Symbol C87414
Ensembl Gene ENSMUSG00000070686
Gene Nameexpressed sequence C87414
Synonyms
MMRRC Submission 041133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4404 (G1)
Quality Score172
Status Not validated
Chromosome5
Chromosomal Location93634993-93671551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93637713 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 236 (H236L)
Ref Sequence ENSEMBL: ENSMUSP00000124780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076321] [ENSMUST00000159578] [ENSMUST00000160382] [ENSMUST00000162964]
Predicted Effect probably benign
Transcript: ENSMUST00000076321
SMART Domains Protein: ENSMUSP00000075662
Gene: ENSMUSG00000070686

DomainStartEndE-ValueType
SCOP:d1a4ya_ 67 191 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159691
Predicted Effect probably benign
Transcript: ENSMUST00000160382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161919
Predicted Effect possibly damaging
Transcript: ENSMUST00000162964
AA Change: H236L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124780
Gene: ENSMUSG00000070686
AA Change: H236L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 388 1e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc188 A G 16: 18,218,420 Q153R probably damaging Het
Dopey1 T A 9: 86,522,813 L1721* probably null Het
Fer A T 17: 63,941,289 probably null Het
Fuk T A 8: 110,890,301 T406S probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Gria4 A T 9: 4,464,489 probably null Het
Gtf3c4 T C 2: 28,826,749 D813G probably damaging Het
Hars2 G T 18: 36,785,936 C83F probably damaging Het
Htr6 A G 4: 139,062,202 S251P probably benign Het
Igsf10 T C 3: 59,329,551 T1070A probably benign Het
Il22ra1 A T 4: 135,737,431 E149D possibly damaging Het
Lama3 G A 18: 12,582,531 M1681I probably benign Het
Loxhd1 G A 18: 77,431,132 G1878D probably damaging Het
Mcc G A 18: 44,759,298 T83M probably benign Het
Nol11 A T 11: 107,173,725 C468S probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Npy5r C T 8: 66,681,992 V50I probably benign Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Pam T C 1: 97,854,721 probably benign Het
Pank4 C T 4: 154,980,156 T724I probably benign Het
Pifo G A 3: 106,001,368 P7L probably benign Het
Sertm1 C T 3: 54,899,325 C93Y probably damaging Het
Slc22a2 A G 17: 12,614,764 T444A probably damaging Het
Trpm7 C A 2: 126,833,715 L489F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn2r76 T C 7: 86,228,303 T511A probably benign Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in C87414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:C87414 APN 5 93636477 missense probably damaging 1.00
IGL01642:C87414 APN 5 93636295 missense possibly damaging 0.84
IGL02735:C87414 APN 5 93638644 missense possibly damaging 0.94
PIT4466001:C87414 UTSW 5 93636288 missense probably damaging 1.00
R1830:C87414 UTSW 5 93637686 missense probably benign 0.03
R2071:C87414 UTSW 5 93636516 missense probably damaging 1.00
R4606:C87414 UTSW 5 93636602 missense probably damaging 0.96
R4672:C87414 UTSW 5 93636323 missense probably damaging 0.99
R5056:C87414 UTSW 5 93638925 start gained probably benign
R5118:C87414 UTSW 5 93637797 missense probably benign 0.03
R5288:C87414 UTSW 5 93637748 missense possibly damaging 0.86
R5441:C87414 UTSW 5 93636597 missense possibly damaging 0.84
R6190:C87414 UTSW 5 93638078 missense probably benign 0.14
R6513:C87414 UTSW 5 93637532 unclassified probably null
R7464:C87414 UTSW 5 93636240 missense probably damaging 1.00
RF006:C87414 UTSW 5 93636703 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGTACCTGACCCAGATCTCC -3'
(R):5'- GCCAAGCAGAGAATAGGATCCC -3'

Sequencing Primer
(F):5'- AGATCTCCATTCTTGCTTACCCTAGG -3'
(R):5'- CTGCTGTATAAAGATGAGGATCTGG -3'
Posted On2015-07-07