Incidental Mutation 'R4404:Zdhhc15'
ID326776
Institutional Source Beutler Lab
Gene Symbol Zdhhc15
Ensembl Gene ENSMUSG00000033906
Gene Namezinc finger, DHHC domain containing 15
Synonyms
MMRRC Submission 041133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4404 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location104536969-104671064 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 104560688 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 322 (R322*)
Ref Sequence ENSEMBL: ENSMUSP00000047615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042070]
Predicted Effect probably null
Transcript: ENSMUST00000042070
AA Change: R322*
SMART Domains Protein: ENSMUSP00000047615
Gene: ENSMUSG00000033906
AA Change: R322*

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 56 73 N/A INTRINSIC
Pfam:zf-DHHC 125 250 2.4e-36 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele exhibit a severe developmental delay and neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C87414 T A 5: 93,637,713 H236L possibly damaging Het
Ccdc188 A G 16: 18,218,420 Q153R probably damaging Het
Dopey1 T A 9: 86,522,813 L1721* probably null Het
Fer A T 17: 63,941,289 probably null Het
Fuk T A 8: 110,890,301 T406S probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Gria4 A T 9: 4,464,489 probably null Het
Gtf3c4 T C 2: 28,826,749 D813G probably damaging Het
Hars2 G T 18: 36,785,936 C83F probably damaging Het
Htr6 A G 4: 139,062,202 S251P probably benign Het
Igsf10 T C 3: 59,329,551 T1070A probably benign Het
Il22ra1 A T 4: 135,737,431 E149D possibly damaging Het
Lama3 G A 18: 12,582,531 M1681I probably benign Het
Loxhd1 G A 18: 77,431,132 G1878D probably damaging Het
Mcc G A 18: 44,759,298 T83M probably benign Het
Nol11 A T 11: 107,173,725 C468S probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Npy5r C T 8: 66,681,992 V50I probably benign Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Pam T C 1: 97,854,721 probably benign Het
Pank4 C T 4: 154,980,156 T724I probably benign Het
Pifo G A 3: 106,001,368 P7L probably benign Het
Sertm1 C T 3: 54,899,325 C93Y probably damaging Het
Slc22a2 A G 17: 12,614,764 T444A probably damaging Het
Trpm7 C A 2: 126,833,715 L489F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn2r76 T C 7: 86,228,303 T511A probably benign Het
Other mutations in Zdhhc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Zdhhc15 APN X 104598106 missense probably benign 0.00
IGL01295:Zdhhc15 APN X 104544913 splice site probably null
IGL01707:Zdhhc15 APN X 104565816 missense probably damaging 0.99
R4407:Zdhhc15 UTSW X 104560688 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTTGCCACCCATATTTGTTA -3'
(R):5'- CCAAAGCCACAATCATATCTCATTT -3'

Sequencing Primer
(F):5'- GTTAAACAAATACTTTCCCTCCTCC -3'
(R):5'- TGCCACCACTCAGGATATTTAG -3'
Posted On2015-07-07