Mutagenetix > Incidental Mutation

Incidental Mutation 'R4415:Gm597'

326777

Institutional Source

Beutler Lab

Gene Symbol

Gm597

Ensembl Gene

ENSMUSG00000048411

Gene Name

predicted gene 597

Synonyms

LOC210962

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R4415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28776117-28780252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28777133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 606 (Q606L)

Ref Sequence

ENSEMBL: ENSMUSP00000058140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059937]

AlphaFold

E9Q8J5

Predicted Effect

probably benign
Transcript: ENSMUST00000059937
AA Change: Q606L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: Q606L

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	112	129	N/A	INTRINSIC
Pfam:FAM75	137	472	8.1e-14	PFAM
low complexity region	664	675	N/A	INTRINSIC
internal_repeat_1	718	807	1.4e-5	PROSPERO
internal_repeat_1	807	894	1.4e-5	PROSPERO

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
Ace3	A	T	11: 106,005,121	D631V	probably benign	Het
Adam17	T	C	12: 21,345,701	I274V	possibly damaging	Het
Aebp1	A	G	11: 5,865,451	D303G	probably damaging	Het
B020004C17Rik	T	C	14: 57,017,417	*233R	probably null	Het
Bcl9l	C	T	9: 44,501,879	P127S	possibly damaging	Het
Bdp1	T	C	13: 100,030,861	D2215G	probably damaging	Het
Caly	T	C	7: 140,072,680	T52A	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Colq	T	C	14: 31,535,688	K231E	probably damaging	Het
Fam32a	T	A	8: 72,221,941	I77N	probably damaging	Het
Impdh1	C	T	6: 29,209,222	V49M	probably damaging	Het
Kcnh7	A	G	2: 62,706,073	I1055T	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lama2	G	T	10: 26,989,344	Y947*	probably null	Het
Myo5b	T	A	18: 74,580,408	I108N	probably damaging	Het
Nvl	T	C	1: 181,105,114	T713A	probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Pappa	A	G	4: 65,305,295	T1236A	probably benign	Het
Rcl1	G	A	19: 29,118,362	V116I	probably benign	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rfx2	T	A	17: 56,787,733	T204S	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor1	T	C	8: 105,617,976	S581P	probably benign	Het
Rnf213	T	A	11: 119,483,964	V5084E	probably damaging	Het
Scn9a	A	T	2: 66,526,693	V1077E	probably damaging	Het
Slc15a5	A	G	6: 138,079,756	V54A	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Snx19	T	A	9: 30,437,483	L804Q	probably damaging	Het
Specc1l	C	A	10: 75,246,328	N519K	possibly damaging	Het
Stambp	A	T	6: 83,557,482	N274K	probably damaging	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Tacc3	T	G	5: 33,666,684		probably null	Het
Tmem55a	C	T	4: 14,912,463	R191C	probably damaging	Het
Tubb1	G	A	2: 174,457,673	E383K	probably benign	Het
Ube3b	A	T	5: 114,412,444	D844V	probably damaging	Het

Other mutations in Gm597

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Gm597	APN	1	28778651	missense	possibly damaging	0.94
IGL00885:Gm597	APN	1	28776845	missense	unknown
IGL01296:Gm597	APN	1	28777056	missense	probably benign	0.23
IGL01476:Gm597	APN	1	28777453	missense	probably benign	0.04
IGL02125:Gm597	APN	1	28776338	missense	possibly damaging	0.91
IGL02410:Gm597	APN	1	28778631	missense	probably benign	0.25
IGL02982:Gm597	APN	1	28778054	missense	probably damaging	1.00
IGL03031:Gm597	APN	1	28778583	missense	probably benign	0.03
IGL03267:Gm597	APN	1	28777121	missense	probably damaging	1.00
R0294:Gm597	UTSW	1	28778663	missense	probably benign	0.00
R0433:Gm597	UTSW	1	28777342	nonsense	probably null
R0485:Gm597	UTSW	1	28778142	missense	probably damaging	1.00
R0645:Gm597	UTSW	1	28776930	missense	probably damaging	0.99
R0744:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R0836:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R1036:Gm597	UTSW	1	28777802	missense	probably benign	0.01
R1302:Gm597	UTSW	1	28776340	missense	probably benign	0.00
R1394:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1395:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1514:Gm597	UTSW	1	28778748	missense	possibly damaging	0.83
R1535:Gm597	UTSW	1	28777424	missense	probably damaging	1.00
R2004:Gm597	UTSW	1	28777179	missense	probably damaging	1.00
R2021:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R2022:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R3115:Gm597	UTSW	1	28776329	missense	possibly damaging	0.92
R3615:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3616:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3862:Gm597	UTSW	1	28777641	missense	probably damaging	0.98
R4067:Gm597	UTSW	1	28777631	missense	probably damaging	0.98
R4119:Gm597	UTSW	1	28777973	missense	probably damaging	0.99
R5010:Gm597	UTSW	1	28777862	missense	possibly damaging	0.52
R5109:Gm597	UTSW	1	28777555	missense	possibly damaging	0.46
R5122:Gm597	UTSW	1	28780060	missense	probably benign	0.00
R5533:Gm597	UTSW	1	28778082	missense	probably damaging	1.00
R6085:Gm597	UTSW	1	28778227	missense	possibly damaging	0.55
R6116:Gm597	UTSW	1	28778699	missense	probably benign	0.01
R6750:Gm597	UTSW	1	28777414	missense	probably damaging	0.98
R6757:Gm597	UTSW	1	28780110	missense	probably damaging	0.98
R6774:Gm597	UTSW	1	28776893	missense	probably benign	0.00
R7156:Gm597	UTSW	1	28776767	missense	possibly damaging	0.53
R7365:Gm597	UTSW	1	28780152	missense	probably benign	0.04
R7739:Gm597	UTSW	1	28777608	missense	possibly damaging	0.72
R7996:Gm597	UTSW	1	28778406	missense	probably damaging	0.98
R8082:Gm597	UTSW	1	28777498	missense	probably benign	0.08
R8281:Gm597	UTSW	1	28778144	missense	possibly damaging	0.77
R8514:Gm597	UTSW	1	28778505	missense	probably damaging	1.00
R8944:Gm597	UTSW	1	28777074	missense	probably benign	0.00
R9042:Gm597	UTSW	1	28776956	missense	possibly damaging	0.72
R9101:Gm597	UTSW	1	28776659	missense	probably benign	0.04
R9106:Gm597	UTSW	1	28776894	missense	probably benign	0.00
R9173:Gm597	UTSW	1	28777349	missense	probably benign	0.22
R9596:Gm597	UTSW	1	28776607	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTGAGCCAGAGCATTAATGAGG -3'
(R):5'- GCCAAATGCTTTCTGGTCC -3'

Sequencing Primer
(F):5'- CCAGAGCATTAATGAGGGCTTG -3'
(R):5'- TTTCTGGTCCCAGGAAAAACC -3'

Posted On

2015-07-07