Incidental Mutation 'R4415:Nvl'
ID 326779
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R4415 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 181087138-181144204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 181105114 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 713 (T713A)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: T713A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: T713A

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191728
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 181105125 missense probably damaging 1.00
IGL00943:Nvl APN 1 181101634 missense possibly damaging 0.72
IGL01956:Nvl APN 1 181134944 missense probably benign 0.00
IGL02657:Nvl APN 1 181106976 missense probably damaging 1.00
Nineveh UTSW 1 181136906 missense probably benign 0.00
nubia UTSW 1 181112334 missense probably benign 0.19
IGL03098:Nvl UTSW 1 181093906 missense probably benign 0.37
P0047:Nvl UTSW 1 181112302 missense probably damaging 1.00
R0003:Nvl UTSW 1 181114133 missense probably damaging 1.00
R0114:Nvl UTSW 1 181120391 missense probably benign 0.19
R0265:Nvl UTSW 1 181134830 missense probably damaging 0.96
R0928:Nvl UTSW 1 181093902 missense probably benign 0.00
R1398:Nvl UTSW 1 181097126 splice site probably benign
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1529:Nvl UTSW 1 181109159 critical splice donor site probably null
R1934:Nvl UTSW 1 181099128 missense probably damaging 0.96
R2176:Nvl UTSW 1 181135074 splice site probably benign
R2351:Nvl UTSW 1 181130792 missense probably benign 0.03
R4570:Nvl UTSW 1 181144082 missense probably benign 0.03
R4720:Nvl UTSW 1 181101587 missense probably damaging 1.00
R4888:Nvl UTSW 1 181117626 missense probably damaging 1.00
R5026:Nvl UTSW 1 181105155 missense probably damaging 1.00
R5507:Nvl UTSW 1 181135036 missense probably damaging 0.98
R5785:Nvl UTSW 1 181139298 missense probably damaging 1.00
R5983:Nvl UTSW 1 181136906 missense probably benign 0.00
R6143:Nvl UTSW 1 181134995 missense probably benign 0.01
R6532:Nvl UTSW 1 181144143 splice site probably null
R6821:Nvl UTSW 1 181126970 nonsense probably null
R7062:Nvl UTSW 1 181112334 missense probably benign 0.19
R7247:Nvl UTSW 1 181112286 critical splice donor site probably null
R7358:Nvl UTSW 1 181135036 missense probably damaging 0.98
R7665:Nvl UTSW 1 181134944 missense probably benign 0.18
R7795:Nvl UTSW 1 181097157 missense probably benign 0.00
R7931:Nvl UTSW 1 181109155 splice site probably benign
R8185:Nvl UTSW 1 181144174 unclassified probably benign
R8806:Nvl UTSW 1 181095054 missense probably benign 0.01
R8933:Nvl UTSW 1 181139073 missense probably benign 0.00
R8975:Nvl UTSW 1 181130436 missense probably benign
R9249:Nvl UTSW 1 181135028 missense probably damaging 1.00
R9584:Nvl UTSW 1 181130866 missense probably benign
R9586:Nvl UTSW 1 181105070 critical splice donor site probably null
X0067:Nvl UTSW 1 181139158 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GAGAAACAATTTCATGAGAATCGAAA -3'
(R):5'- TTCCACAGAACCTCATCAAGAGC -3'

Sequencing Primer
(F):5'- GTGAACTGAACACAGGCCCTTTTG -3'
(R):5'- AGACAGGTGCTAGTGTTC -3'
Posted On 2015-07-07