Incidental Mutation 'R4415:Rin2'
ID326782
Institutional Source Beutler Lab
Gene Symbol Rin2
Ensembl Gene ENSMUSG00000001768
Gene NameRas and Rab interactor 2
SynonymsRASSF4, 4632403N06Rik, 2010003K16Rik
Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location145675215-145887616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145860446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 354 (T354I)
Ref Sequence ENSEMBL: ENSMUSP00000105632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]
Predicted Effect probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

DomainStartEndE-ValueType
SH2 50 136 1.38e-3 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
Blast:SH2 540 576 2e-7 BLAST
VPS9 612 730 1.72e-68 SMART
RA 751 842 3.35e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

DomainStartEndE-ValueType
SH2 95 181 1.38e-3 SMART
low complexity region 220 232 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
low complexity region 438 456 N/A INTRINSIC
Blast:SH2 585 621 2e-7 BLAST
VPS9 657 775 1.72e-68 SMART
RA 796 887 3.35e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145874
Predicted Effect probably benign
Transcript: ENSMUST00000147976
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Rin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Rin2 APN 2 145860006 splice site probably benign
IGL03222:Rin2 APN 2 145860195 nonsense probably null
IGL03371:Rin2 APN 2 145885926 utr 3 prime probably benign
IGL03411:Rin2 APN 2 145860944 missense probably damaging 0.99
D4043:Rin2 UTSW 2 145822363 missense possibly damaging 0.61
R0025:Rin2 UTSW 2 145878832 splice site probably benign
R0110:Rin2 UTSW 2 145861033 missense probably benign
R0144:Rin2 UTSW 2 145876639 missense probably damaging 0.96
R0510:Rin2 UTSW 2 145861033 missense probably benign
R1326:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1327:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1328:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1329:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1330:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1544:Rin2 UTSW 2 145858446 missense probably damaging 1.00
R1658:Rin2 UTSW 2 145876456 missense probably benign 0.04
R1832:Rin2 UTSW 2 145861171 missense possibly damaging 0.48
R1986:Rin2 UTSW 2 145878940 missense probably damaging 1.00
R2137:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2167:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2170:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2260:Rin2 UTSW 2 145878904 missense probably damaging 0.97
R2312:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2884:Rin2 UTSW 2 145860991 missense probably benign 0.07
R3155:Rin2 UTSW 2 145860851 missense probably benign 0.17
R3771:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3772:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3773:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3822:Rin2 UTSW 2 145822630 missense probably benign 0.02
R3824:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3825:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3885:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3893:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3939:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3940:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4012:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4019:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4058:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4214:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4231:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4232:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4236:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4372:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4410:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4471:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4490:Rin2 UTSW 2 145822274 missense possibly damaging 0.66
R4597:Rin2 UTSW 2 145860905 missense probably benign 0.01
R5099:Rin2 UTSW 2 145878901 missense probably damaging 1.00
R5268:Rin2 UTSW 2 145844760 missense probably benign
R5493:Rin2 UTSW 2 145860709 missense probably damaging 1.00
R5622:Rin2 UTSW 2 145860379 missense probably benign 0.07
R5947:Rin2 UTSW 2 145844943 intron probably benign
R6280:Rin2 UTSW 2 145861019 missense probably damaging 1.00
R7009:Rin2 UTSW 2 145883475 missense probably damaging 1.00
R7531:Rin2 UTSW 2 145858499 missense probably benign
R7824:Rin2 UTSW 2 145861117 missense probably benign 0.00
R8065:Rin2 UTSW 2 145861057 missense probably damaging 0.99
R8067:Rin2 UTSW 2 145861057 missense probably damaging 0.99
R8144:Rin2 UTSW 2 145822305 missense probably benign
R8510:Rin2 UTSW 2 145885691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGTGCACAGCCAGGAC -3'
(R):5'- AGTGGAAAGGCTCATGTCG -3'

Sequencing Primer
(F):5'- AGGACTCCCAACGCGAATGG -3'
(R):5'- AAAGGCTCATGTCGCTCAG -3'
Posted On2015-07-07