Incidental Mutation 'R4415:Stambp'
ID326789
Institutional Source Beutler Lab
Gene Symbol Stambp
Ensembl Gene ENSMUSG00000006906
Gene NameSTAM binding protein
Synonyms5730422L11Rik, Amsh, 5330424L14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83543211-83572729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83557482 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 274 (N274K)
Ref Sequence ENSEMBL: ENSMUSP00000146294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068054] [ENSMUST00000206400] [ENSMUST00000206592]
Predicted Effect probably damaging
Transcript: ENSMUST00000068054
AA Change: N274K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070876
Gene: ENSMUSG00000006906
AA Change: N274K

DomainStartEndE-ValueType
Pfam:USP8_dimer 8 117 4.9e-23 PFAM
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 200 N/A INTRINSIC
JAB_MPN 256 382 1.81e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205648
Predicted Effect probably damaging
Transcript: ENSMUST00000206400
AA Change: N274K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206592
AA Change: N274K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytokine-mediated signal transduction in the JAK-STAT cascade requires the involvement of adaptor molecules. One such signal-transducing adaptor molecule contains an SH3 domain that is required for induction of MYC and cell growth. The protein encoded by this gene binds to the SH3 domain of the signal-transducing adaptor molecule, and plays a critical role in cytokine-mediated signaling for MYC induction and cell cycle progression. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die of starvation at weaning exhibiting postnatal growth retardation, limb-clasping, a hypocellular cerebral cortex, and severe loss of hippocampal CA1 neurons accompanied by apoptosis; one-third of mutant mice display blepharoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Stambp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Stambp APN 6 83556298 missense probably damaging 1.00
IGL00720:Stambp APN 6 83570437 missense probably damaging 1.00
IGL02019:Stambp APN 6 83552031 missense probably damaging 1.00
IGL02328:Stambp APN 6 83556381 missense possibly damaging 0.62
IGL02716:Stambp APN 6 83556390 missense probably damaging 1.00
IGL03069:Stambp APN 6 83561932 missense probably damaging 1.00
R0465:Stambp UTSW 6 83570339 missense probably benign 0.38
R0699:Stambp UTSW 6 83556321 missense probably damaging 1.00
R1170:Stambp UTSW 6 83563821 critical splice donor site probably null
R2234:Stambp UTSW 6 83551978 missense probably damaging 1.00
R3724:Stambp UTSW 6 83557466 missense probably damaging 1.00
R4617:Stambp UTSW 6 83561978 nonsense probably null
R4857:Stambp UTSW 6 83556366 missense probably benign 0.00
R5109:Stambp UTSW 6 83563821 critical splice donor site probably null
R5578:Stambp UTSW 6 83561800 missense probably benign 0.00
R7378:Stambp UTSW 6 83563906 missense not run
R7652:Stambp UTSW 6 83563928 splice site probably null
R8353:Stambp UTSW 6 83561899 missense probably damaging 1.00
R8803:Stambp UTSW 6 83547230 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAATTAAGCCTCCTTCTCACC -3'
(R):5'- CACTATTCCAAAGGGAGAAATAGGC -3'

Sequencing Primer
(F):5'- ATTGGCCCAAGACTTGTCAG -3'
(R):5'- ATGGCTGATCCCTACGGAG -3'
Posted On2015-07-07