Incidental Mutation 'R4415:Ripor1'
ID326793
Institutional Source Beutler Lab
Gene Symbol Ripor1
Ensembl Gene ENSMUSG00000038604
Gene NameRHO family interacting cell polarization regulator 1
SynonymsFam65a, 2310066E14Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105605255-105622219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105617976 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 581 (S581P)
Ref Sequence ENSEMBL: ENSMUSP00000039966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043531] [ENSMUST00000194091]
Predicted Effect probably benign
Transcript: ENSMUST00000043531
AA Change: S581P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039966
Gene: ENSMUSG00000038604
AA Change: S581P

DomainStartEndE-ValueType
Pfam:PL48 17 365 1.7e-170 PFAM
low complexity region 376 391 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 564 586 N/A INTRINSIC
low complexity region 595 655 N/A INTRINSIC
low complexity region 673 688 N/A INTRINSIC
low complexity region 748 771 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
Pfam:HEAT_2 1135 1209 3.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158807
Predicted Effect probably benign
Transcript: ENSMUST00000194091
SMART Domains Protein: ENSMUSP00000142044
Gene: ENSMUSG00000005705

DomainStartEndE-ValueType
Agouti 1 121 2.01e-56 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Ripor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ripor1 APN 8 105621433 intron probably benign
IGL00658:Ripor1 APN 8 105618117 intron probably benign
IGL01511:Ripor1 APN 8 105619930 intron probably benign
IGL01733:Ripor1 APN 8 105615746 missense possibly damaging 0.63
IGL02805:Ripor1 APN 8 105617571 missense probably damaging 0.99
IGL03049:Ripor1 APN 8 105615447 missense probably damaging 0.96
IGL03246:Ripor1 APN 8 105615858 missense possibly damaging 0.92
R0650:Ripor1 UTSW 8 105618114 intron probably benign
R1109:Ripor1 UTSW 8 105618928 intron probably benign
R1480:Ripor1 UTSW 8 105615548 missense probably damaging 0.96
R1914:Ripor1 UTSW 8 105616886 missense probably damaging 1.00
R1915:Ripor1 UTSW 8 105616886 missense probably damaging 1.00
R2067:Ripor1 UTSW 8 105617708 missense probably benign 0.05
R2111:Ripor1 UTSW 8 105614712 missense probably damaging 1.00
R2513:Ripor1 UTSW 8 105617622 missense probably benign 0.27
R4119:Ripor1 UTSW 8 105618857 intron probably benign
R4120:Ripor1 UTSW 8 105618857 intron probably benign
R4668:Ripor1 UTSW 8 105614652 missense probably benign 0.30
R4679:Ripor1 UTSW 8 105617785 missense possibly damaging 0.94
R4777:Ripor1 UTSW 8 105614990 missense probably damaging 1.00
R4930:Ripor1 UTSW 8 105617182 missense probably damaging 1.00
R5004:Ripor1 UTSW 8 105618820 frame shift probably null
R5569:Ripor1 UTSW 8 105617515 missense probably damaging 0.98
R5868:Ripor1 UTSW 8 105616004 missense probably damaging 1.00
R7187:Ripor1 UTSW 8 105617874 missense probably benign 0.22
R7311:Ripor1 UTSW 8 105617815 nonsense probably null
R8117:Ripor1 UTSW 8 105617473 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGCTAGACTTGGTTCACAAAAC -3'
(R):5'- AGCACCGGTGGTATGAGTTG -3'

Sequencing Primer
(F):5'- GTTCACAAAACCACAGACTCCG -3'
(R):5'- CACCGGTGGTATGAGTTGACATC -3'
Posted On2015-07-07