Mutagenetix > Incidental Mutations

Incidental Mutation 'R4415:Bcl9l'

326795

Institutional Source

Beutler Lab

Gene Symbol

Bcl9l

Ensembl Gene

ENSMUSG00000063382

Gene Name

B cell CLL/lymphoma 9-like

Synonyms

DLNB11

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44482825-44511896 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 44501879 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 127 (P127S)

Ref Sequence

ENSEMBL: ENSMUSP00000151342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074989] [ENSMUST00000218183] [ENSMUST00000218913] [ENSMUST00000220303]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074989
AA Change: P164S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382
AA Change: P164S

Domain	Start	End	E-Value	Type
low complexity region	215	234	N/A	INTRINSIC
PDB:2XB1\|C	236	269	2e-14	PDB
low complexity region	278	292	N/A	INTRINSIC
low complexity region	297	325	N/A	INTRINSIC
low complexity region	337	376	N/A	INTRINSIC
Pfam:BCL9	395	432	2.4e-18	PFAM
low complexity region	490	507	N/A	INTRINSIC
low complexity region	521	534	N/A	INTRINSIC
low complexity region	546	560	N/A	INTRINSIC
low complexity region	590	602	N/A	INTRINSIC
low complexity region	766	783	N/A	INTRINSIC
low complexity region	835	852	N/A	INTRINSIC
low complexity region	1042	1059	N/A	INTRINSIC
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1167	1178	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217898

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218183
AA Change: P164S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000218913

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220292

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220303
AA Change: P127S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
Ace3	A	T	11: 106,005,121	D631V	probably benign	Het
Adam17	T	C	12: 21,345,701	I274V	possibly damaging	Het
Aebp1	A	G	11: 5,865,451	D303G	probably damaging	Het
B020004C17Rik	T	C	14: 57,017,417	*233R	probably null	Het
Bdp1	T	C	13: 100,030,861	D2215G	probably damaging	Het
Caly	T	C	7: 140,072,680	T52A	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Colq	T	C	14: 31,535,688	K231E	probably damaging	Het
Fam32a	T	A	8: 72,221,941	I77N	probably damaging	Het
Gm597	T	A	1: 28,777,133	Q606L	probably benign	Het
Impdh1	C	T	6: 29,209,222	V49M	probably damaging	Het
Kcnh7	A	G	2: 62,706,073	I1055T	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lama2	G	T	10: 26,989,344	Y947*	probably null	Het
Myo5b	T	A	18: 74,580,408	I108N	probably damaging	Het
Nvl	T	C	1: 181,105,114	T713A	probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Pappa	A	G	4: 65,305,295	T1236A	probably benign	Het
Rcl1	G	A	19: 29,118,362	V116I	probably benign	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rfx2	T	A	17: 56,787,733	T204S	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor1	T	C	8: 105,617,976	S581P	probably benign	Het
Rnf213	T	A	11: 119,483,964	V5084E	probably damaging	Het
Scn9a	A	T	2: 66,526,693	V1077E	probably damaging	Het
Slc15a5	A	G	6: 138,079,756	V54A	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Snx19	T	A	9: 30,437,483	L804Q	probably damaging	Het
Specc1l	C	A	10: 75,246,328	N519K	possibly damaging	Het
Stambp	A	T	6: 83,557,482	N274K	probably damaging	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Tacc3	T	G	5: 33,666,684		probably null	Het
Tmem55a	C	T	4: 14,912,463	R191C	probably damaging	Het
Tubb1	G	A	2: 174,457,673	E383K	probably benign	Het
Ube3b	A	T	5: 114,412,444	D844V	probably damaging	Het

Other mutations in Bcl9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Bcl9l	APN	9	44505627	missense	possibly damaging	0.86
IGL00969:Bcl9l	APN	9	44508242	missense	possibly damaging	0.79
IGL01011:Bcl9l	APN	9	44505179	missense	possibly damaging	0.85
IGL01396:Bcl9l	APN	9	44506824	missense	probably damaging	0.99
IGL02015:Bcl9l	APN	9	44508801	splice site	probably null
IGL02106:Bcl9l	APN	9	44509199	missense	probably benign	0.03
IGL02310:Bcl9l	APN	9	44509305	missense	probably damaging	1.00
IGL02447:Bcl9l	APN	9	44507334	missense	probably benign	0.09
IGL02534:Bcl9l	APN	9	44505739	missense	probably benign	0.00
IGL02541:Bcl9l	APN	9	44507769	missense	probably benign	0.02
IGL02688:Bcl9l	APN	9	44505263	missense	possibly damaging	0.86
IGL02931:Bcl9l	APN	9	44500750	missense	probably damaging	0.96
R0098:Bcl9l	UTSW	9	44505617	missense	probably benign
R0142:Bcl9l	UTSW	9	44507112	missense	probably benign	0.09
R0193:Bcl9l	UTSW	9	44507406	missense	probably damaging	1.00
R0227:Bcl9l	UTSW	9	44505236	missense	possibly damaging	0.96
R0481:Bcl9l	UTSW	9	44506682	missense	probably benign
R0496:Bcl9l	UTSW	9	44509518	missense	probably benign	0.00
R1741:Bcl9l	UTSW	9	44509689	missense	probably damaging	0.99
R1971:Bcl9l	UTSW	9	44508699	splice site	probably null
R1976:Bcl9l	UTSW	9	44506152	missense	possibly damaging	0.76
R4751:Bcl9l	UTSW	9	44506803	missense	probably damaging	0.99
R4810:Bcl9l	UTSW	9	44508353	missense	probably damaging	1.00
R4880:Bcl9l	UTSW	9	44508710	missense	probably benign	0.01
R4967:Bcl9l	UTSW	9	44505068	missense	possibly damaging	0.85
R5418:Bcl9l	UTSW	9	44505436	missense	possibly damaging	0.53
R5572:Bcl9l	UTSW	9	44500798	missense	possibly damaging	0.66
R5658:Bcl9l	UTSW	9	44509169	missense	probably damaging	1.00
R5812:Bcl9l	UTSW	9	44506644	missense	probably benign	0.01
R6515:Bcl9l	UTSW	9	44507874	splice site	probably null
R6670:Bcl9l	UTSW	9	44507072	small insertion	probably benign
R6682:Bcl9l	UTSW	9	44501103	missense	possibly damaging	0.91
R6966:Bcl9l	UTSW	9	44509388	nonsense	probably null
R7171:Bcl9l	UTSW	9	44505151	missense	probably benign	0.33
R7338:Bcl9l	UTSW	9	44508708	missense	probably benign
R7448:Bcl9l	UTSW	9	44509337	missense	probably benign	0.00
R7609:Bcl9l	UTSW	9	44505747	missense	probably damaging	0.99
R7793:Bcl9l	UTSW	9	44508966	missense	probably benign	0.00
R7793:Bcl9l	UTSW	9	44509697	missense	probably damaging	0.97
R8372:Bcl9l	UTSW	9	44507231	missense	probably benign
R8491:Bcl9l	UTSW	9	44500768	missense	probably benign	0.02
R8769:Bcl9l	UTSW	9	44508966	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACTCTGGAGAATGGTCTGGGAG -3'
(R):5'- TGTCCGGAAAAGGGATTACC -3'

Sequencing Primer
(F):5'- AGGGCCTCTGCATGTGGAAG -3'
(R):5'- GGATTACCTGAGAGACCTTCGAC -3'

Posted On

2015-07-07