Mutagenetix > Incidental Mutation

Incidental Mutation 'R4415:Oit3'

326797

Institutional Source

Beutler Lab

Gene Symbol

Oit3

Ensembl Gene

ENSMUSG00000009654

Gene Name

oncoprotein induced transcript 3

Synonyms

EF-9

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.463) question?

Stock #

R4415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59422958-59441778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59428103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 403 (Y403C)

Ref Sequence

ENSEMBL: ENSMUSP00000009798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009798]

AlphaFold

Q8R4V5

Predicted Effect

probably damaging
Transcript: ENSMUST00000009798
AA Change: Y403C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: Y403C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:ZP	50	144	9e-24	BLAST
EGF	150	181	2.16e1	SMART
EGF	185	222	2.94e-3	SMART
EGF	226	263	2.35e-2	SMART
ZP	267	516	2.74e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162493

Meta Mutation Damage Score

0.5154

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
Ace3	A	T	11: 106,005,121	D631V	probably benign	Het
Adam17	T	C	12: 21,345,701	I274V	possibly damaging	Het
Aebp1	A	G	11: 5,865,451	D303G	probably damaging	Het
B020004C17Rik	T	C	14: 57,017,417	*233R	probably null	Het
Bcl9l	C	T	9: 44,501,879	P127S	possibly damaging	Het
Bdp1	T	C	13: 100,030,861	D2215G	probably damaging	Het
Caly	T	C	7: 140,072,680	T52A	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Colq	T	C	14: 31,535,688	K231E	probably damaging	Het
Fam32a	T	A	8: 72,221,941	I77N	probably damaging	Het
Gm597	T	A	1: 28,777,133	Q606L	probably benign	Het
Impdh1	C	T	6: 29,209,222	V49M	probably damaging	Het
Kcnh7	A	G	2: 62,706,073	I1055T	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lama2	G	T	10: 26,989,344	Y947*	probably null	Het
Myo5b	T	A	18: 74,580,408	I108N	probably damaging	Het
Nvl	T	C	1: 181,105,114	T713A	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Pappa	A	G	4: 65,305,295	T1236A	probably benign	Het
Rcl1	G	A	19: 29,118,362	V116I	probably benign	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rfx2	T	A	17: 56,787,733	T204S	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor1	T	C	8: 105,617,976	S581P	probably benign	Het
Rnf213	T	A	11: 119,483,964	V5084E	probably damaging	Het
Scn9a	A	T	2: 66,526,693	V1077E	probably damaging	Het
Slc15a5	A	G	6: 138,079,756	V54A	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Snx19	T	A	9: 30,437,483	L804Q	probably damaging	Het
Specc1l	C	A	10: 75,246,328	N519K	possibly damaging	Het
Stambp	A	T	6: 83,557,482	N274K	probably damaging	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Tacc3	T	G	5: 33,666,684		probably null	Het
Tmem55a	C	T	4: 14,912,463	R191C	probably damaging	Het
Tubb1	G	A	2: 174,457,673	E383K	probably benign	Het
Ube3b	A	T	5: 114,412,444	D844V	probably damaging	Het

Other mutations in Oit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Oit3	APN	10	59425484	unclassified	probably benign
IGL01665:Oit3	APN	10	59438909	missense	probably damaging	1.00
IGL01839:Oit3	APN	10	59429496	missense	probably damaging	0.98
IGL02028:Oit3	APN	10	59438655	missense	probably damaging	0.98
PIT4585001:Oit3	UTSW	10	59431013	missense	possibly damaging	0.54
R0567:Oit3	UTSW	10	59435978	missense	probably damaging	0.99
R0781:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1110:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1563:Oit3	UTSW	10	59428074	missense	probably damaging	1.00
R1623:Oit3	UTSW	10	59428239	missense	probably damaging	0.99
R1693:Oit3	UTSW	10	59425417	missense	probably damaging	1.00
R1754:Oit3	UTSW	10	59427940	splice site	probably null
R1853:Oit3	UTSW	10	59441622	critical splice donor site	probably null
R2070:Oit3	UTSW	10	59431013	missense	probably benign	0.03
R2211:Oit3	UTSW	10	59428070	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59428345	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59441685	start gained	probably benign
R3103:Oit3	UTSW	10	59438891	missense	probably damaging	0.98
R4414:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4416:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4417:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4584:Oit3	UTSW	10	59425462	missense	probably damaging	1.00
R4734:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4748:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4749:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R5070:Oit3	UTSW	10	59424027	missense	probably damaging	1.00
R5521:Oit3	UTSW	10	59435914	missense	probably benign
R6326:Oit3	UTSW	10	59428239	missense	probably damaging	1.00
R6490:Oit3	UTSW	10	59438552	missense	possibly damaging	0.92
R6526:Oit3	UTSW	10	59429640	missense	probably damaging	1.00
R6766:Oit3	UTSW	10	59438712	missense	probably damaging	0.99
R6921:Oit3	UTSW	10	59435945	missense	probably damaging	0.99
R7129:Oit3	UTSW	10	59428344	missense	probably damaging	0.99
R7440:Oit3	UTSW	10	59429570	missense	probably damaging	0.99
R7495:Oit3	UTSW	10	59423943	missense	possibly damaging	0.74
R7512:Oit3	UTSW	10	59438894	missense	probably damaging	1.00
R7866:Oit3	UTSW	10	59424030	missense	probably benign	0.03
R8312:Oit3	UTSW	10	59438810	missense	probably benign	0.01
R8321:Oit3	UTSW	10	59428160	missense	probably benign	0.00
R8919:Oit3	UTSW	10	59441646	missense	unknown
R9131:Oit3	UTSW	10	59435929	missense	probably benign	0.01
R9457:Oit3	UTSW	10	59441683	start codon destroyed	unknown
R9478:Oit3	UTSW	10	59438642	missense	probably damaging	0.99
R9502:Oit3	UTSW	10	59428351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATTCCACAGGTGTCTCAAGTG -3'
(R):5'- CAGCAAACTGTTGATCCCCG -3'

Sequencing Primer
(F):5'- CTGTTTTACGACCAAATTCAATGG -3'
(R):5'- AAACTGTTGATCCCCGTGACCTG -3'

Posted On

2015-07-07