Incidental Mutation 'R4415:Stox1'
ID326798
Institutional Source Beutler Lab
Gene Symbol Stox1
Ensembl Gene ENSMUSG00000036923
Gene Namestorkhead box 1
Synonyms4732470K04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62659043-62726128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62659569 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 975 (N975S)
Ref Sequence ENSEMBL: ENSMUSP00000114652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133371] [ENSMUST00000148720]
Predicted Effect probably benign
Transcript: ENSMUST00000133371
AA Change: N975S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: N975S

DomainStartEndE-ValueType
low complexity region 31 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Stork_head 108 186 4.4e-37 PFAM
low complexity region 416 429 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148720
SMART Domains Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923

DomainStartEndE-ValueType
Pfam:Stork_head 19 98 9e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Stox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Stox1 APN 10 62667913 missense probably damaging 1.00
IGL01462:Stox1 APN 10 62664682 missense probably benign 0.14
IGL01558:Stox1 APN 10 62667872 missense probably damaging 0.98
IGL02391:Stox1 APN 10 62659676 splice site probably benign
IGL02454:Stox1 APN 10 62667826 missense probably damaging 1.00
IGL02510:Stox1 APN 10 62664047 missense probably benign 0.14
IGL02635:Stox1 APN 10 62664906 missense probably benign 0.02
R1036:Stox1 UTSW 10 62667895 missense probably damaging 1.00
R1486:Stox1 UTSW 10 62664636 missense probably benign 0.06
R1751:Stox1 UTSW 10 62659666 missense probably damaging 0.97
R1763:Stox1 UTSW 10 62667965 missense probably damaging 1.00
R1892:Stox1 UTSW 10 62665399 missense possibly damaging 0.56
R2128:Stox1 UTSW 10 62664535 missense probably benign 0.42
R2406:Stox1 UTSW 10 62664166 missense probably benign 0.01
R4078:Stox1 UTSW 10 62666031 missense probably benign 0.00
R4414:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4416:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4417:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4799:Stox1 UTSW 10 62665737 missense probably damaging 1.00
R5261:Stox1 UTSW 10 62667841 missense probably damaging 0.98
R5323:Stox1 UTSW 10 62664033 missense possibly damaging 0.71
R5885:Stox1 UTSW 10 62664848 missense probably damaging 0.99
R6182:Stox1 UTSW 10 62664942 missense probably damaging 0.99
R7548:Stox1 UTSW 10 62666167 missense probably damaging 0.99
R7757:Stox1 UTSW 10 62663964 missense probably damaging 1.00
R7765:Stox1 UTSW 10 62665999 missense probably benign 0.26
R7846:Stox1 UTSW 10 62659526 missense probably damaging 1.00
R7867:Stox1 UTSW 10 62664944 missense probably benign 0.00
R8077:Stox1 UTSW 10 62665566 missense probably damaging 1.00
R8409:Stox1 UTSW 10 62666016 missense probably benign 0.00
R8413:Stox1 UTSW 10 62664975 missense probably damaging 1.00
R8443:Stox1 UTSW 10 62665764 missense probably damaging 1.00
R8822:Stox1 UTSW 10 62664121 missense probably damaging 1.00
RF014:Stox1 UTSW 10 62664246 missense probably benign 0.06
Z1176:Stox1 UTSW 10 62664018 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAGCTTCCAAGGACTTTCAC -3'
(R):5'- TCCTAATGGTACTGGGAGGC -3'

Sequencing Primer
(F):5'- CCAGTTTCTACAAGAGTTCTCCAAAG -3'
(R):5'- ACATGAGAATGTGTTTCTGAAGG -3'
Posted On2015-07-07