Mutagenetix > Incidental Mutation

Incidental Mutation 'R4415:Stox1'

326798

Institutional Source

Beutler Lab

Gene Symbol

Stox1

Ensembl Gene

ENSMUSG00000036923

Gene Name

storkhead box 1

Synonyms

4732470K04Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.246) question?

Stock #

R4415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62659043-62726128 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62659569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 975 (N975S)

Ref Sequence

ENSEMBL: ENSMUSP00000114652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133371] [ENSMUST00000148720]

AlphaFold

B2RQL2

Predicted Effect

probably benign
Transcript: ENSMUST00000133371
AA Change: N975S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: N975S

Domain	Start	End	E-Value	Type
low complexity region	31	71	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC
Pfam:Stork_head	108	186	4.4e-37	PFAM
low complexity region	416	429	N/A	INTRINSIC
low complexity region	448	459	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148720

SMART Domains

Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923

Domain	Start	End	E-Value	Type
Pfam:Stork_head	19	98	9e-40	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
Ace3	A	T	11: 106,005,121	D631V	probably benign	Het
Adam17	T	C	12: 21,345,701	I274V	possibly damaging	Het
Aebp1	A	G	11: 5,865,451	D303G	probably damaging	Het
B020004C17Rik	T	C	14: 57,017,417	*233R	probably null	Het
Bcl9l	C	T	9: 44,501,879	P127S	possibly damaging	Het
Bdp1	T	C	13: 100,030,861	D2215G	probably damaging	Het
Caly	T	C	7: 140,072,680	T52A	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Colq	T	C	14: 31,535,688	K231E	probably damaging	Het
Fam32a	T	A	8: 72,221,941	I77N	probably damaging	Het
Gm597	T	A	1: 28,777,133	Q606L	probably benign	Het
Impdh1	C	T	6: 29,209,222	V49M	probably damaging	Het
Kcnh7	A	G	2: 62,706,073	I1055T	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lama2	G	T	10: 26,989,344	Y947*	probably null	Het
Myo5b	T	A	18: 74,580,408	I108N	probably damaging	Het
Nvl	T	C	1: 181,105,114	T713A	probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Pappa	A	G	4: 65,305,295	T1236A	probably benign	Het
Rcl1	G	A	19: 29,118,362	V116I	probably benign	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rfx2	T	A	17: 56,787,733	T204S	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor1	T	C	8: 105,617,976	S581P	probably benign	Het
Rnf213	T	A	11: 119,483,964	V5084E	probably damaging	Het
Scn9a	A	T	2: 66,526,693	V1077E	probably damaging	Het
Slc15a5	A	G	6: 138,079,756	V54A	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Snx19	T	A	9: 30,437,483	L804Q	probably damaging	Het
Specc1l	C	A	10: 75,246,328	N519K	possibly damaging	Het
Stambp	A	T	6: 83,557,482	N274K	probably damaging	Het
Tacc3	T	G	5: 33,666,684		probably null	Het
Tmem55a	C	T	4: 14,912,463	R191C	probably damaging	Het
Tubb1	G	A	2: 174,457,673	E383K	probably benign	Het
Ube3b	A	T	5: 114,412,444	D844V	probably damaging	Het

Other mutations in Stox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Stox1	APN	10	62667913	missense	probably damaging	1.00
IGL01462:Stox1	APN	10	62664682	missense	probably benign	0.14
IGL01558:Stox1	APN	10	62667872	missense	probably damaging	0.98
IGL02391:Stox1	APN	10	62659676	splice site	probably benign
IGL02454:Stox1	APN	10	62667826	missense	probably damaging	1.00
IGL02510:Stox1	APN	10	62664047	missense	probably benign	0.14
IGL02635:Stox1	APN	10	62664906	missense	probably benign	0.02
R1036:Stox1	UTSW	10	62667895	missense	probably damaging	1.00
R1486:Stox1	UTSW	10	62664636	missense	probably benign	0.06
R1751:Stox1	UTSW	10	62659666	missense	probably damaging	0.97
R1763:Stox1	UTSW	10	62667965	missense	probably damaging	1.00
R1892:Stox1	UTSW	10	62665399	missense	possibly damaging	0.56
R2128:Stox1	UTSW	10	62664535	missense	probably benign	0.42
R2406:Stox1	UTSW	10	62664166	missense	probably benign	0.01
R4078:Stox1	UTSW	10	62666031	missense	probably benign	0.00
R4414:Stox1	UTSW	10	62659569	missense	probably benign	0.00
R4416:Stox1	UTSW	10	62659569	missense	probably benign	0.00
R4417:Stox1	UTSW	10	62659569	missense	probably benign	0.00
R4799:Stox1	UTSW	10	62665737	missense	probably damaging	1.00
R5261:Stox1	UTSW	10	62667841	missense	probably damaging	0.98
R5323:Stox1	UTSW	10	62664033	missense	possibly damaging	0.71
R5885:Stox1	UTSW	10	62664848	missense	probably damaging	0.99
R6182:Stox1	UTSW	10	62664942	missense	probably damaging	0.99
R7548:Stox1	UTSW	10	62666167	missense	probably damaging	0.99
R7757:Stox1	UTSW	10	62663964	missense	probably damaging	1.00
R7765:Stox1	UTSW	10	62665999	missense	probably benign	0.26
R7846:Stox1	UTSW	10	62659526	missense	probably damaging	1.00
R7867:Stox1	UTSW	10	62664944	missense	probably benign	0.00
R8077:Stox1	UTSW	10	62665566	missense	probably damaging	1.00
R8409:Stox1	UTSW	10	62666016	missense	probably benign	0.00
R8413:Stox1	UTSW	10	62664975	missense	probably damaging	1.00
R8443:Stox1	UTSW	10	62665764	missense	probably damaging	1.00
R8822:Stox1	UTSW	10	62664121	missense	probably damaging	1.00
R8888:Stox1	UTSW	10	62659607	missense	probably benign	0.05
R8895:Stox1	UTSW	10	62659607	missense	probably benign	0.05
R8937:Stox1	UTSW	10	62664651	missense	probably damaging	0.96
R9012:Stox1	UTSW	10	62664832	missense	probably benign	0.00
R9201:Stox1	UTSW	10	62665573	missense	probably damaging	1.00
RF014:Stox1	UTSW	10	62664246	missense	probably benign	0.06
Z1176:Stox1	UTSW	10	62664018	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TACAGCTTCCAAGGACTTTCAC -3'
(R):5'- TCCTAATGGTACTGGGAGGC -3'

Sequencing Primer
(F):5'- CCAGTTTCTACAAGAGTTCTCCAAAG -3'
(R):5'- ACATGAGAATGTGTTTCTGAAGG -3'

Posted On

2015-07-07