Incidental Mutation 'R4415:Stox1'
ID 326798
Institutional Source Beutler Lab
Gene Symbol Stox1
Ensembl Gene ENSMUSG00000036923
Gene Name storkhead box 1
Synonyms 4732470K04Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R4415 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 62494822-62561907 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62495348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 975 (N975S)
Ref Sequence ENSEMBL: ENSMUSP00000114652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133371] [ENSMUST00000148720]
AlphaFold B2RQL2
Predicted Effect probably benign
Transcript: ENSMUST00000133371
AA Change: N975S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: N975S

DomainStartEndE-ValueType
low complexity region 31 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Stork_head 108 186 4.4e-37 PFAM
low complexity region 416 429 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148720
SMART Domains Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923

DomainStartEndE-ValueType
Pfam:Stork_head 19 98 9e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A T 11: 105,895,947 (GRCm39) D631V probably benign Het
Adam17 T C 12: 21,395,702 (GRCm39) I274V possibly damaging Het
Aebp1 A G 11: 5,815,451 (GRCm39) D303G probably damaging Het
B020004C17Rik T C 14: 57,254,874 (GRCm39) *233R probably null Het
Bcl9l C T 9: 44,413,176 (GRCm39) P127S possibly damaging Het
Bdp1 T C 13: 100,167,369 (GRCm39) D2215G probably damaging Het
Caly T C 7: 139,652,593 (GRCm39) T52A probably damaging Het
Ccdc125 T C 13: 100,832,817 (GRCm39) S465P possibly damaging Het
Cdc23 ACC AC 18: 34,770,371 (GRCm39) probably null Het
Colq T C 14: 31,257,645 (GRCm39) K231E probably damaging Het
Fam32a T A 8: 72,975,785 (GRCm39) I77N probably damaging Het
Impdh1 C T 6: 29,209,221 (GRCm39) V49M probably damaging Het
Kcnh7 A G 2: 62,536,417 (GRCm39) I1055T probably damaging Het
Lad1 A G 1: 135,756,484 (GRCm39) D364G probably benign Het
Lama2 G T 10: 26,865,340 (GRCm39) Y947* probably null Het
Myo5b T A 18: 74,713,479 (GRCm39) I108N probably damaging Het
Nvl T C 1: 180,932,679 (GRCm39) T713A probably benign Het
Oit3 T C 10: 59,263,925 (GRCm39) Y403C probably damaging Het
Or6c70 T C 10: 129,709,826 (GRCm39) T267A probably benign Het
Pappa A G 4: 65,223,532 (GRCm39) T1236A probably benign Het
Pip4p2 C T 4: 14,912,463 (GRCm39) R191C probably damaging Het
Rcl1 G A 19: 29,095,762 (GRCm39) V116I probably benign Het
Rdh14 G A 12: 10,441,231 (GRCm39) probably null Het
Rfx2 T A 17: 57,094,733 (GRCm39) T204S possibly damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Ripor1 T C 8: 106,344,608 (GRCm39) S581P probably benign Het
Rnf213 T A 11: 119,374,790 (GRCm39) V5084E probably damaging Het
Scn9a A T 2: 66,357,037 (GRCm39) V1077E probably damaging Het
Slc15a5 A G 6: 138,056,754 (GRCm39) V54A probably benign Het
Slc35b2 G A 17: 45,877,355 (GRCm39) V161M probably benign Het
Snx19 T A 9: 30,348,779 (GRCm39) L804Q probably damaging Het
Spata31e5 T A 1: 28,816,214 (GRCm39) Q606L probably benign Het
Specc1l C A 10: 75,082,162 (GRCm39) N519K possibly damaging Het
Spmip6 T C 4: 41,505,574 (GRCm39) T183A possibly damaging Het
Stambp A T 6: 83,534,464 (GRCm39) N274K probably damaging Het
Tacc3 T G 5: 33,824,028 (GRCm39) probably null Het
Tubb1 G A 2: 174,299,466 (GRCm39) E383K probably benign Het
Ube3b A T 5: 114,550,505 (GRCm39) D844V probably damaging Het
Other mutations in Stox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Stox1 APN 10 62,503,692 (GRCm39) missense probably damaging 1.00
IGL01462:Stox1 APN 10 62,500,461 (GRCm39) missense probably benign 0.14
IGL01558:Stox1 APN 10 62,503,651 (GRCm39) missense probably damaging 0.98
IGL02391:Stox1 APN 10 62,495,455 (GRCm39) splice site probably benign
IGL02454:Stox1 APN 10 62,503,605 (GRCm39) missense probably damaging 1.00
IGL02510:Stox1 APN 10 62,499,826 (GRCm39) missense probably benign 0.14
IGL02635:Stox1 APN 10 62,500,685 (GRCm39) missense probably benign 0.02
R1036:Stox1 UTSW 10 62,503,674 (GRCm39) missense probably damaging 1.00
R1486:Stox1 UTSW 10 62,500,415 (GRCm39) missense probably benign 0.06
R1751:Stox1 UTSW 10 62,495,445 (GRCm39) missense probably damaging 0.97
R1763:Stox1 UTSW 10 62,503,744 (GRCm39) missense probably damaging 1.00
R1892:Stox1 UTSW 10 62,501,178 (GRCm39) missense possibly damaging 0.56
R2128:Stox1 UTSW 10 62,500,314 (GRCm39) missense probably benign 0.42
R2406:Stox1 UTSW 10 62,499,945 (GRCm39) missense probably benign 0.01
R4078:Stox1 UTSW 10 62,501,810 (GRCm39) missense probably benign 0.00
R4414:Stox1 UTSW 10 62,495,348 (GRCm39) missense probably benign 0.00
R4416:Stox1 UTSW 10 62,495,348 (GRCm39) missense probably benign 0.00
R4417:Stox1 UTSW 10 62,495,348 (GRCm39) missense probably benign 0.00
R4799:Stox1 UTSW 10 62,501,516 (GRCm39) missense probably damaging 1.00
R5261:Stox1 UTSW 10 62,503,620 (GRCm39) missense probably damaging 0.98
R5323:Stox1 UTSW 10 62,499,812 (GRCm39) missense possibly damaging 0.71
R5885:Stox1 UTSW 10 62,500,627 (GRCm39) missense probably damaging 0.99
R6182:Stox1 UTSW 10 62,500,721 (GRCm39) missense probably damaging 0.99
R7548:Stox1 UTSW 10 62,501,946 (GRCm39) missense probably damaging 0.99
R7757:Stox1 UTSW 10 62,499,743 (GRCm39) missense probably damaging 1.00
R7765:Stox1 UTSW 10 62,501,778 (GRCm39) missense probably benign 0.26
R7846:Stox1 UTSW 10 62,495,305 (GRCm39) missense probably damaging 1.00
R7867:Stox1 UTSW 10 62,500,723 (GRCm39) missense probably benign 0.00
R8077:Stox1 UTSW 10 62,501,345 (GRCm39) missense probably damaging 1.00
R8409:Stox1 UTSW 10 62,501,795 (GRCm39) missense probably benign 0.00
R8413:Stox1 UTSW 10 62,500,754 (GRCm39) missense probably damaging 1.00
R8443:Stox1 UTSW 10 62,501,543 (GRCm39) missense probably damaging 1.00
R8822:Stox1 UTSW 10 62,499,900 (GRCm39) missense probably damaging 1.00
R8888:Stox1 UTSW 10 62,495,386 (GRCm39) missense probably benign 0.05
R8895:Stox1 UTSW 10 62,495,386 (GRCm39) missense probably benign 0.05
R8937:Stox1 UTSW 10 62,500,430 (GRCm39) missense probably damaging 0.96
R9012:Stox1 UTSW 10 62,500,611 (GRCm39) missense probably benign 0.00
R9201:Stox1 UTSW 10 62,501,352 (GRCm39) missense probably damaging 1.00
RF014:Stox1 UTSW 10 62,500,025 (GRCm39) missense probably benign 0.06
Z1176:Stox1 UTSW 10 62,499,797 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAGCTTCCAAGGACTTTCAC -3'
(R):5'- TCCTAATGGTACTGGGAGGC -3'

Sequencing Primer
(F):5'- CCAGTTTCTACAAGAGTTCTCCAAAG -3'
(R):5'- ACATGAGAATGTGTTTCTGAAGG -3'
Posted On 2015-07-07