Incidental Mutation 'R4415:Olfr814'
ID326800
Institutional Source Beutler Lab
Gene Symbol Olfr814
Ensembl Gene ENSMUSG00000059134
Gene Nameolfactory receptor 814
SynonymsMOR113-5, MOR113-8, GA_x6K02T2PULF-11553313-11552381
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129871473-129879851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129873957 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000150458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
Predicted Effect probably benign
Transcript: ENSMUST00000081367
AA Change: T267A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: T267A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213742
AA Change: T267A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216966
AA Change: T267A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Olfr814
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Olfr814 APN 10 129874031 missense probably damaging 1.00
IGL02045:Olfr814 APN 10 129874222 missense probably benign 0.22
IGL02301:Olfr814 APN 10 129874079 missense probably damaging 0.99
R0277:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0281:Olfr814 UTSW 10 129874546 missense possibly damaging 0.88
R0323:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0394:Olfr814 UTSW 10 129873942 missense probably benign 0.29
R0546:Olfr814 UTSW 10 129874538 missense possibly damaging 0.94
R3813:Olfr814 UTSW 10 129873986 missense probably damaging 1.00
R4086:Olfr814 UTSW 10 129874298 missense possibly damaging 0.49
R4416:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4453:Olfr814 UTSW 10 129874661 missense probably null 0.30
R5194:Olfr814 UTSW 10 129874098 missense probably benign 0.00
R5306:Olfr814 UTSW 10 129873941 missense probably damaging 0.97
R5362:Olfr814 UTSW 10 129874553 missense probably damaging 1.00
R5609:Olfr814 UTSW 10 129874738 missense probably benign 0.01
R5987:Olfr814 UTSW 10 129874521 missense probably damaging 0.98
R6240:Olfr814 UTSW 10 129874677 missense probably benign
R6896:Olfr814 UTSW 10 129874754 start codon destroyed probably null 0.98
R7432:Olfr814 UTSW 10 129873850 missense probably benign
R7489:Olfr814 UTSW 10 129874682 missense probably damaging 1.00
R7652:Olfr814 UTSW 10 129874477 missense probably damaging 0.99
R8316:Olfr814 UTSW 10 129874022 missense probably damaging 1.00
R8725:Olfr814 UTSW 10 129874223 missense probably damaging 1.00
R8727:Olfr814 UTSW 10 129874223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGAGTACTTTTAGCCTG -3'
(R):5'- CACAAGTTTACTAGAAGTGATGGC -3'

Sequencing Primer
(F):5'- GGAGTACTTTTAGCCTGTTTAATACC -3'
(R):5'- GATGGCTTTCATCTTAGCTCTCATG -3'
Posted On2015-07-07