Incidental Mutation 'R4415:Ace3'
ID326803
Institutional Source Beutler Lab
Gene Symbol Ace3
Ensembl Gene ENSMUSG00000101605
Gene Nameangiotensin I converting enzyme (peptidyl-dipeptidase A) 3
SynonymsEG217246
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105994675-106005443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106005121 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 631 (D631V)
Ref Sequence ENSEMBL: ENSMUSP00000140827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539] [ENSMUST00000190995]
Predicted Effect probably benign
Transcript: ENSMUST00000001965
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106903
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145539
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190995
AA Change: D631V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140827
Gene: ENSMUSG00000101605
AA Change: D631V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Peptidase_M2 25 616 2e-265 PFAM
transmembrane domain 638 660 N/A INTRINSIC
transmembrane domain 700 722 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm number, motility, and fertilization ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Ace3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1932:Ace3 UTSW 11 106004610 critical splice donor site probably null
R4074:Ace3 UTSW 11 105997214 missense probably damaging 1.00
R5315:Ace3 UTSW 11 105994921 missense probably benign 0.00
R5325:Ace3 UTSW 11 106005253 missense probably benign
R5846:Ace3 UTSW 11 105998362 missense probably benign 0.06
R5866:Ace3 UTSW 11 105997504 missense probably damaging 0.99
R6122:Ace3 UTSW 11 105994938 missense probably benign 0.08
R6160:Ace3 UTSW 11 105994732 missense possibly damaging 0.51
R6815:Ace3 UTSW 11 105997258 nonsense probably null
R8031:Ace3 UTSW 11 105998098 critical splice donor site probably null
R8179:Ace3 UTSW 11 106004557 missense probably benign 0.15
R8349:Ace3 UTSW 11 105994942 missense probably damaging 1.00
R8449:Ace3 UTSW 11 105994942 missense probably damaging 1.00
R8679:Ace3 UTSW 11 105995875 missense probably benign 0.00
R8780:Ace3 UTSW 11 105997538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGAGTTAGGTCACCTGAC -3'
(R):5'- AGCAGAAGCCACTGTTTCCG -3'

Sequencing Primer
(F):5'- ATGTCCCCTCTCACTGCAGG -3'
(R):5'- AGCCACTGTTTCCGGGCTG -3'
Posted On2015-07-07