Incidental Mutation 'R4415:Adam17'
ID326806
Institutional Source Beutler Lab
Gene Symbol Adam17
Ensembl Gene ENSMUSG00000052593
Gene Namea disintegrin and metallopeptidase domain 17
SynonymsCD156b, Tace
Accession Numbers

Genbank: NM_009615; MGI: 1096335

Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location21323509-21373632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21345701 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 274 (I274V)
Ref Sequence ENSEMBL: ENSMUSP00000099087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000142092] [ENSMUST00000145118] [ENSMUST00000232107] [ENSMUST00000232526]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064536
AA Change: I255V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: I255V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101551
AA Change: I274V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: I274V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127974
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142092
SMART Domains Protein: ENSMUSP00000136255
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145118
AA Change: I255V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593
AA Change: I255V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155115
Predicted Effect probably benign
Transcript: ENSMUST00000232107
Predicted Effect probably benign
Transcript: ENSMUST00000232526
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Adam17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21328109 missense probably damaging 1.00
IGL01340:Adam17 APN 12 21330057 nonsense probably null
IGL01973:Adam17 APN 12 21349943 missense probably damaging 1.00
IGL02223:Adam17 APN 12 21361705 missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21345697 missense probably damaging 1.00
Steinway UTSW 12 21353948 missense probably damaging 1.00
wavedx UTSW 12 21340750 missense probably damaging 1.00
R0014:Adam17 UTSW 12 21336644 missense probably benign 0.36
R0080:Adam17 UTSW 12 21329048 splice site probably benign
R0082:Adam17 UTSW 12 21329048 splice site probably benign
R0324:Adam17 UTSW 12 21349938 missense probably benign 0.00
R0511:Adam17 UTSW 12 21340458 splice site probably benign
R0745:Adam17 UTSW 12 21332221 splice site probably benign
R1314:Adam17 UTSW 12 21329071 missense probably damaging 1.00
R1547:Adam17 UTSW 12 21353957 missense probably damaging 1.00
R1594:Adam17 UTSW 12 21340470 critical splice donor site probably null
R1607:Adam17 UTSW 12 21334138 splice site probably null
R1812:Adam17 UTSW 12 21361767 missense probably damaging 0.97
R2020:Adam17 UTSW 12 21349875 missense probably damaging 1.00
R3408:Adam17 UTSW 12 21329118 missense probably damaging 1.00
R3735:Adam17 UTSW 12 21325412 missense probably benign 0.05
R3886:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R3888:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R4062:Adam17 UTSW 12 21325457 missense probably damaging 1.00
R4563:Adam17 UTSW 12 21332088 missense probably damaging 1.00
R4658:Adam17 UTSW 12 21332160 missense probably damaging 1.00
R4763:Adam17 UTSW 12 21334015 missense probably benign
R4793:Adam17 UTSW 12 21347395 missense probably benign
R5101:Adam17 UTSW 12 21373405 missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21343019 intron probably benign
R5514:Adam17 UTSW 12 21340519 missense probably damaging 0.98
R5592:Adam17 UTSW 12 21334137 missense probably damaging 1.00
R5874:Adam17 UTSW 12 21329086 missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6451:Adam17 UTSW 12 21342882 missense probably benign 0.00
R6930:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6970:Adam17 UTSW 12 21345668 missense probably benign 0.06
R7213:Adam17 UTSW 12 21336678 nonsense probably null
R7302:Adam17 UTSW 12 21355693 intron probably benign
R7361:Adam17 UTSW 12 21325601 missense probably damaging 0.98
R7667:Adam17 UTSW 12 21333952 critical splice donor site probably null
R7799:Adam17 UTSW 12 21340492 missense probably damaging 1.00
R8762:Adam17 UTSW 12 21351594 missense probably benign 0.03
X0063:Adam17 UTSW 12 21332585 missense probably benign 0.17
Z1176:Adam17 UTSW 12 21361737 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAAAGTCTGACACATGATCAG -3'
(R):5'- GGGGTAACTTCTTGATATACCCC -3'

Sequencing Primer
(F):5'- TGTAATGAGATCTGACGCCC -3'
(R):5'- TACCCCTCAGTGGTAAAGATTGG -3'
Posted On2015-07-07