Incidental Mutation 'R4415:Adam17'
ID 326806
Institutional Source Beutler Lab
Gene Symbol Adam17
Ensembl Gene ENSMUSG00000052593
Gene Name a disintegrin and metallopeptidase domain 17
Synonyms CD156b, Tace
Accession Numbers
Essential gene? Probably essential (E-score: 0.922) question?
Stock # R4415 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 21373510-21423633 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21395702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 274 (I274V)
Ref Sequence ENSEMBL: ENSMUSP00000099087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000142092] [ENSMUST00000145118] [ENSMUST00000232107] [ENSMUST00000232526]
AlphaFold Q9Z0F8
Predicted Effect possibly damaging
Transcript: ENSMUST00000064536
AA Change: I255V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: I255V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101551
AA Change: I274V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: I274V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127974
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142092
SMART Domains Protein: ENSMUSP00000136255
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145118
AA Change: I255V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593
AA Change: I255V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155115
Predicted Effect probably benign
Transcript: ENSMUST00000232107
Predicted Effect probably benign
Transcript: ENSMUST00000232526
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A T 11: 105,895,947 (GRCm39) D631V probably benign Het
Aebp1 A G 11: 5,815,451 (GRCm39) D303G probably damaging Het
B020004C17Rik T C 14: 57,254,874 (GRCm39) *233R probably null Het
Bcl9l C T 9: 44,413,176 (GRCm39) P127S possibly damaging Het
Bdp1 T C 13: 100,167,369 (GRCm39) D2215G probably damaging Het
Caly T C 7: 139,652,593 (GRCm39) T52A probably damaging Het
Ccdc125 T C 13: 100,832,817 (GRCm39) S465P possibly damaging Het
Cdc23 ACC AC 18: 34,770,371 (GRCm39) probably null Het
Colq T C 14: 31,257,645 (GRCm39) K231E probably damaging Het
Fam32a T A 8: 72,975,785 (GRCm39) I77N probably damaging Het
Impdh1 C T 6: 29,209,221 (GRCm39) V49M probably damaging Het
Kcnh7 A G 2: 62,536,417 (GRCm39) I1055T probably damaging Het
Lad1 A G 1: 135,756,484 (GRCm39) D364G probably benign Het
Lama2 G T 10: 26,865,340 (GRCm39) Y947* probably null Het
Myo5b T A 18: 74,713,479 (GRCm39) I108N probably damaging Het
Nvl T C 1: 180,932,679 (GRCm39) T713A probably benign Het
Oit3 T C 10: 59,263,925 (GRCm39) Y403C probably damaging Het
Or6c70 T C 10: 129,709,826 (GRCm39) T267A probably benign Het
Pappa A G 4: 65,223,532 (GRCm39) T1236A probably benign Het
Pip4p2 C T 4: 14,912,463 (GRCm39) R191C probably damaging Het
Rcl1 G A 19: 29,095,762 (GRCm39) V116I probably benign Het
Rdh14 G A 12: 10,441,231 (GRCm39) probably null Het
Rfx2 T A 17: 57,094,733 (GRCm39) T204S possibly damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Ripor1 T C 8: 106,344,608 (GRCm39) S581P probably benign Het
Rnf213 T A 11: 119,374,790 (GRCm39) V5084E probably damaging Het
Scn9a A T 2: 66,357,037 (GRCm39) V1077E probably damaging Het
Slc15a5 A G 6: 138,056,754 (GRCm39) V54A probably benign Het
Slc35b2 G A 17: 45,877,355 (GRCm39) V161M probably benign Het
Snx19 T A 9: 30,348,779 (GRCm39) L804Q probably damaging Het
Spata31e5 T A 1: 28,816,214 (GRCm39) Q606L probably benign Het
Specc1l C A 10: 75,082,162 (GRCm39) N519K possibly damaging Het
Spmip6 T C 4: 41,505,574 (GRCm39) T183A possibly damaging Het
Stambp A T 6: 83,534,464 (GRCm39) N274K probably damaging Het
Stox1 T C 10: 62,495,348 (GRCm39) N975S probably benign Het
Tacc3 T G 5: 33,824,028 (GRCm39) probably null Het
Tubb1 G A 2: 174,299,466 (GRCm39) E383K probably benign Het
Ube3b A T 5: 114,550,505 (GRCm39) D844V probably damaging Het
Other mutations in Adam17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21,378,110 (GRCm39) missense probably damaging 1.00
IGL01340:Adam17 APN 12 21,380,058 (GRCm39) nonsense probably null
IGL01973:Adam17 APN 12 21,399,944 (GRCm39) missense probably damaging 1.00
IGL02223:Adam17 APN 12 21,411,706 (GRCm39) missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21,395,698 (GRCm39) missense probably damaging 1.00
Steinway UTSW 12 21,403,949 (GRCm39) missense probably damaging 1.00
wavedx UTSW 12 21,390,751 (GRCm39) missense probably damaging 1.00
R0014:Adam17 UTSW 12 21,386,645 (GRCm39) missense probably benign 0.36
R0080:Adam17 UTSW 12 21,379,049 (GRCm39) splice site probably benign
R0082:Adam17 UTSW 12 21,379,049 (GRCm39) splice site probably benign
R0324:Adam17 UTSW 12 21,399,939 (GRCm39) missense probably benign 0.00
R0511:Adam17 UTSW 12 21,390,459 (GRCm39) splice site probably benign
R0745:Adam17 UTSW 12 21,382,222 (GRCm39) splice site probably benign
R1314:Adam17 UTSW 12 21,379,072 (GRCm39) missense probably damaging 1.00
R1547:Adam17 UTSW 12 21,403,958 (GRCm39) missense probably damaging 1.00
R1594:Adam17 UTSW 12 21,390,471 (GRCm39) critical splice donor site probably null
R1607:Adam17 UTSW 12 21,384,139 (GRCm39) splice site probably null
R1812:Adam17 UTSW 12 21,411,768 (GRCm39) missense probably damaging 0.97
R2020:Adam17 UTSW 12 21,399,876 (GRCm39) missense probably damaging 1.00
R3408:Adam17 UTSW 12 21,379,119 (GRCm39) missense probably damaging 1.00
R3735:Adam17 UTSW 12 21,375,413 (GRCm39) missense probably benign 0.05
R3886:Adam17 UTSW 12 21,375,588 (GRCm39) missense probably damaging 1.00
R3888:Adam17 UTSW 12 21,375,588 (GRCm39) missense probably damaging 1.00
R4062:Adam17 UTSW 12 21,375,458 (GRCm39) missense probably damaging 1.00
R4563:Adam17 UTSW 12 21,382,089 (GRCm39) missense probably damaging 1.00
R4658:Adam17 UTSW 12 21,382,161 (GRCm39) missense probably damaging 1.00
R4763:Adam17 UTSW 12 21,384,016 (GRCm39) missense probably benign
R4793:Adam17 UTSW 12 21,397,396 (GRCm39) missense probably benign
R5101:Adam17 UTSW 12 21,423,406 (GRCm39) missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21,393,020 (GRCm39) intron probably benign
R5514:Adam17 UTSW 12 21,390,520 (GRCm39) missense probably damaging 0.98
R5592:Adam17 UTSW 12 21,384,138 (GRCm39) missense probably damaging 1.00
R5874:Adam17 UTSW 12 21,379,087 (GRCm39) missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21,403,949 (GRCm39) missense probably damaging 1.00
R6451:Adam17 UTSW 12 21,392,883 (GRCm39) missense probably benign 0.00
R6930:Adam17 UTSW 12 21,403,949 (GRCm39) missense probably damaging 1.00
R6970:Adam17 UTSW 12 21,395,669 (GRCm39) missense probably benign 0.06
R7213:Adam17 UTSW 12 21,386,679 (GRCm39) nonsense probably null
R7302:Adam17 UTSW 12 21,405,694 (GRCm39) intron probably benign
R7361:Adam17 UTSW 12 21,375,602 (GRCm39) missense probably damaging 0.98
R7667:Adam17 UTSW 12 21,383,953 (GRCm39) critical splice donor site probably null
R7799:Adam17 UTSW 12 21,390,493 (GRCm39) missense probably damaging 1.00
R8762:Adam17 UTSW 12 21,401,595 (GRCm39) missense probably benign 0.03
R8958:Adam17 UTSW 12 21,399,934 (GRCm39) missense possibly damaging 0.61
R9108:Adam17 UTSW 12 21,380,132 (GRCm39) missense probably benign
R9163:Adam17 UTSW 12 21,401,588 (GRCm39) missense probably benign 0.00
R9295:Adam17 UTSW 12 21,399,938 (GRCm39) missense probably benign 0.02
R9345:Adam17 UTSW 12 21,378,056 (GRCm39) missense probably damaging 1.00
R9444:Adam17 UTSW 12 21,375,536 (GRCm39) missense probably benign 0.28
R9522:Adam17 UTSW 12 21,395,693 (GRCm39) missense probably damaging 1.00
R9582:Adam17 UTSW 12 21,386,665 (GRCm39) missense probably benign 0.14
X0063:Adam17 UTSW 12 21,382,586 (GRCm39) missense probably benign 0.17
Z1176:Adam17 UTSW 12 21,411,738 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAAAGTCTGACACATGATCAG -3'
(R):5'- GGGGTAACTTCTTGATATACCCC -3'

Sequencing Primer
(F):5'- TGTAATGAGATCTGACGCCC -3'
(R):5'- TACCCCTCAGTGGTAAAGATTGG -3'
Posted On 2015-07-07