Mutagenetix > Incidental Mutation

Incidental Mutation 'R4415:Bdp1'

326807

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100030861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2215 (D2215G)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

AlphaFold

Q571C7

Predicted Effect

probably damaging
Transcript: ENSMUST00000038104
AA Change: D2215G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: D2215G

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099262

Predicted Effect

probably damaging
Transcript: ENSMUST00000109379
AA Change: D2215G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: D2215G

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Meta Mutation Damage Score

0.0810

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
Ace3	A	T	11: 106,005,121	D631V	probably benign	Het
Adam17	T	C	12: 21,345,701	I274V	possibly damaging	Het
Aebp1	A	G	11: 5,865,451	D303G	probably damaging	Het
B020004C17Rik	T	C	14: 57,017,417	*233R	probably null	Het
Bcl9l	C	T	9: 44,501,879	P127S	possibly damaging	Het
Caly	T	C	7: 140,072,680	T52A	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Colq	T	C	14: 31,535,688	K231E	probably damaging	Het
Fam32a	T	A	8: 72,221,941	I77N	probably damaging	Het
Gm597	T	A	1: 28,777,133	Q606L	probably benign	Het
Impdh1	C	T	6: 29,209,222	V49M	probably damaging	Het
Kcnh7	A	G	2: 62,706,073	I1055T	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lama2	G	T	10: 26,989,344	Y947*	probably null	Het
Myo5b	T	A	18: 74,580,408	I108N	probably damaging	Het
Nvl	T	C	1: 181,105,114	T713A	probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Pappa	A	G	4: 65,305,295	T1236A	probably benign	Het
Rcl1	G	A	19: 29,118,362	V116I	probably benign	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rfx2	T	A	17: 56,787,733	T204S	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor1	T	C	8: 105,617,976	S581P	probably benign	Het
Rnf213	T	A	11: 119,483,964	V5084E	probably damaging	Het
Scn9a	A	T	2: 66,526,693	V1077E	probably damaging	Het
Slc15a5	A	G	6: 138,079,756	V54A	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Snx19	T	A	9: 30,437,483	L804Q	probably damaging	Het
Specc1l	C	A	10: 75,246,328	N519K	possibly damaging	Het
Stambp	A	T	6: 83,557,482	N274K	probably damaging	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Tacc3	T	G	5: 33,666,684		probably null	Het
Tmem55a	C	T	4: 14,912,463	R191C	probably damaging	Het
Tubb1	G	A	2: 174,457,673	E383K	probably benign	Het
Ube3b	A	T	5: 114,412,444	D844V	probably damaging	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
R8688:Bdp1	UTSW	13	100103799	missense	probably damaging	1.00
R8871:Bdp1	UTSW	13	100049667	missense	probably damaging	1.00
R8976:Bdp1	UTSW	13	100060899	nonsense	probably null
R8987:Bdp1	UTSW	13	100067513	missense	probably benign	0.01
R9157:Bdp1	UTSW	13	100049928	missense	probably benign	0.40
R9437:Bdp1	UTSW	13	100025650	missense	probably benign	0.31
R9612:Bdp1	UTSW	13	100077862	missense	probably benign	0.18
R9679:Bdp1	UTSW	13	100043777	missense	probably damaging	0.98
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTAGGTTTCCTGATTAATGTCC -3'
(R):5'- AGCAGCTTCTAACTCACTGC -3'

Sequencing Primer
(F):5'- GCCATATGTCTATACGCCAGTATG -3'
(R):5'- AGCAGCTTCTAACTCACTGCTTTTG -3'

Posted On

2015-07-07