Incidental Mutation 'R4415:Bdp1'
ID 326807
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene Name B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms Tfnr, TFIIIB90, TFC5, B130055N23Rik, TAF3B1, TFIIIB150, G630013P12Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4415 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100154502-100240578 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100167369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2215 (D2215G)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
AlphaFold Q571C7
Predicted Effect probably damaging
Transcript: ENSMUST00000038104
AA Change: D2215G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: D2215G

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably damaging
Transcript: ENSMUST00000109379
AA Change: D2215G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: D2215G

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Meta Mutation Damage Score 0.0810 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A T 11: 105,895,947 (GRCm39) D631V probably benign Het
Adam17 T C 12: 21,395,702 (GRCm39) I274V possibly damaging Het
Aebp1 A G 11: 5,815,451 (GRCm39) D303G probably damaging Het
B020004C17Rik T C 14: 57,254,874 (GRCm39) *233R probably null Het
Bcl9l C T 9: 44,413,176 (GRCm39) P127S possibly damaging Het
Caly T C 7: 139,652,593 (GRCm39) T52A probably damaging Het
Ccdc125 T C 13: 100,832,817 (GRCm39) S465P possibly damaging Het
Cdc23 ACC AC 18: 34,770,371 (GRCm39) probably null Het
Colq T C 14: 31,257,645 (GRCm39) K231E probably damaging Het
Fam32a T A 8: 72,975,785 (GRCm39) I77N probably damaging Het
Impdh1 C T 6: 29,209,221 (GRCm39) V49M probably damaging Het
Kcnh7 A G 2: 62,536,417 (GRCm39) I1055T probably damaging Het
Lad1 A G 1: 135,756,484 (GRCm39) D364G probably benign Het
Lama2 G T 10: 26,865,340 (GRCm39) Y947* probably null Het
Myo5b T A 18: 74,713,479 (GRCm39) I108N probably damaging Het
Nvl T C 1: 180,932,679 (GRCm39) T713A probably benign Het
Oit3 T C 10: 59,263,925 (GRCm39) Y403C probably damaging Het
Or6c70 T C 10: 129,709,826 (GRCm39) T267A probably benign Het
Pappa A G 4: 65,223,532 (GRCm39) T1236A probably benign Het
Pip4p2 C T 4: 14,912,463 (GRCm39) R191C probably damaging Het
Rcl1 G A 19: 29,095,762 (GRCm39) V116I probably benign Het
Rdh14 G A 12: 10,441,231 (GRCm39) probably null Het
Rfx2 T A 17: 57,094,733 (GRCm39) T204S possibly damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Ripor1 T C 8: 106,344,608 (GRCm39) S581P probably benign Het
Rnf213 T A 11: 119,374,790 (GRCm39) V5084E probably damaging Het
Scn9a A T 2: 66,357,037 (GRCm39) V1077E probably damaging Het
Slc15a5 A G 6: 138,056,754 (GRCm39) V54A probably benign Het
Slc35b2 G A 17: 45,877,355 (GRCm39) V161M probably benign Het
Snx19 T A 9: 30,348,779 (GRCm39) L804Q probably damaging Het
Spata31e5 T A 1: 28,816,214 (GRCm39) Q606L probably benign Het
Specc1l C A 10: 75,082,162 (GRCm39) N519K possibly damaging Het
Spmip6 T C 4: 41,505,574 (GRCm39) T183A possibly damaging Het
Stambp A T 6: 83,534,464 (GRCm39) N274K probably damaging Het
Stox1 T C 10: 62,495,348 (GRCm39) N975S probably benign Het
Tacc3 T G 5: 33,824,028 (GRCm39) probably null Het
Tubb1 G A 2: 174,299,466 (GRCm39) E383K probably benign Het
Ube3b A T 5: 114,550,505 (GRCm39) D844V probably damaging Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100,235,018 (GRCm39) missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100,197,373 (GRCm39) missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100,197,706 (GRCm39) missense probably benign 0.00
IGL00924:Bdp1 APN 13 100,234,087 (GRCm39) missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100,192,700 (GRCm39) missense probably benign 0.00
IGL01344:Bdp1 APN 13 100,214,588 (GRCm39) missense probably benign 0.06
IGL01347:Bdp1 APN 13 100,206,711 (GRCm39) missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100,220,713 (GRCm39) splice site probably benign
IGL01871:Bdp1 APN 13 100,202,561 (GRCm39) missense probably benign 0.01
IGL02008:Bdp1 APN 13 100,160,335 (GRCm39) missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100,174,308 (GRCm39) missense probably benign 0.02
IGL02214:Bdp1 APN 13 100,178,043 (GRCm39) missense probably benign 0.00
IGL02236:Bdp1 APN 13 100,197,399 (GRCm39) missense probably benign
IGL02307:Bdp1 APN 13 100,229,946 (GRCm39) missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100,191,816 (GRCm39) splice site probably benign
IGL02415:Bdp1 APN 13 100,225,916 (GRCm39) missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100,235,022 (GRCm39) missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100,214,623 (GRCm39) critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100,188,047 (GRCm39) missense probably benign 0.29
IGL02738:Bdp1 APN 13 100,187,861 (GRCm39) missense probably benign 0.26
IGL02754:Bdp1 APN 13 100,197,481 (GRCm39) missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100,178,778 (GRCm39) missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100,191,800 (GRCm39) missense probably benign 0.00
IGL03156:Bdp1 APN 13 100,197,544 (GRCm39) missense probably benign 0.44
IGL03166:Bdp1 APN 13 100,172,308 (GRCm39) missense probably benign 0.28
IGL03232:Bdp1 APN 13 100,187,989 (GRCm39) missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100,160,129 (GRCm39) missense probably benign 0.02
R0115:Bdp1 UTSW 13 100,177,962 (GRCm39) missense probably benign 0.28
R0481:Bdp1 UTSW 13 100,177,962 (GRCm39) missense probably benign 0.28
R0619:Bdp1 UTSW 13 100,174,366 (GRCm39) missense probably benign 0.00
R0730:Bdp1 UTSW 13 100,195,459 (GRCm39) splice site probably benign
R0744:Bdp1 UTSW 13 100,172,333 (GRCm39) missense probably benign 0.01
R0833:Bdp1 UTSW 13 100,172,333 (GRCm39) missense probably benign 0.01
R1307:Bdp1 UTSW 13 100,186,271 (GRCm39) missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100,235,516 (GRCm39) missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100,215,263 (GRCm39) nonsense probably null
R1644:Bdp1 UTSW 13 100,197,448 (GRCm39) missense probably benign 0.03
R1670:Bdp1 UTSW 13 100,163,941 (GRCm39) critical splice donor site probably null
R1836:Bdp1 UTSW 13 100,171,653 (GRCm39) missense probably benign
R1869:Bdp1 UTSW 13 100,178,709 (GRCm39) missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100,235,097 (GRCm39) missense probably benign 0.30
R1944:Bdp1 UTSW 13 100,210,889 (GRCm39) splice site probably null
R2030:Bdp1 UTSW 13 100,197,697 (GRCm39) missense probably benign 0.00
R2069:Bdp1 UTSW 13 100,187,496 (GRCm39) missense probably benign 0.00
R2180:Bdp1 UTSW 13 100,197,913 (GRCm39) small insertion probably benign
R2263:Bdp1 UTSW 13 100,202,545 (GRCm39) missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100,197,847 (GRCm39) missense probably damaging 1.00
R2277:Bdp1 UTSW 13 100,197,838 (GRCm39) missense probably benign 0.05
R2278:Bdp1 UTSW 13 100,197,847 (GRCm39) missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100,197,838 (GRCm39) missense probably benign 0.05
R2336:Bdp1 UTSW 13 100,189,510 (GRCm39) missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100,196,878 (GRCm39) missense probably benign 0.08
R3154:Bdp1 UTSW 13 100,186,322 (GRCm39) missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100,196,093 (GRCm39) missense probably benign
R4322:Bdp1 UTSW 13 100,228,731 (GRCm39) missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100,167,369 (GRCm39) missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100,192,775 (GRCm39) missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100,186,376 (GRCm39) missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100,187,627 (GRCm39) missense probably benign 0.26
R4914:Bdp1 UTSW 13 100,192,844 (GRCm39) missense probably benign 0.28
R4917:Bdp1 UTSW 13 100,191,713 (GRCm39) missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100,191,713 (GRCm39) missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100,167,302 (GRCm39) nonsense probably null
R5266:Bdp1 UTSW 13 100,204,043 (GRCm39) missense probably benign 0.33
R5312:Bdp1 UTSW 13 100,234,109 (GRCm39) splice site probably null
R5420:Bdp1 UTSW 13 100,202,551 (GRCm39) missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100,235,018 (GRCm39) missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100,228,794 (GRCm39) missense probably benign 0.08
R5913:Bdp1 UTSW 13 100,187,612 (GRCm39) missense probably benign 0.41
R6018:Bdp1 UTSW 13 100,174,732 (GRCm39) missense probably benign 0.00
R6037:Bdp1 UTSW 13 100,163,957 (GRCm39) missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100,163,957 (GRCm39) missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100,162,036 (GRCm39) missense probably benign 0.00
R6969:Bdp1 UTSW 13 100,211,039 (GRCm39) missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100,174,269 (GRCm39) missense probably null 1.00
R6996:Bdp1 UTSW 13 100,180,321 (GRCm39) missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100,215,215 (GRCm39) missense probably benign 0.03
R7060:Bdp1 UTSW 13 100,196,002 (GRCm39) missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100,206,689 (GRCm39) missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100,197,659 (GRCm39) missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100,186,478 (GRCm39) missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100,186,478 (GRCm39) missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100,178,040 (GRCm39) missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100,187,457 (GRCm39) missense probably benign 0.03
R7562:Bdp1 UTSW 13 100,162,049 (GRCm39) missense probably benign 0.04
R7583:Bdp1 UTSW 13 100,186,320 (GRCm39) missense probably damaging 1.00
R7788:Bdp1 UTSW 13 100,191,759 (GRCm39) missense possibly damaging 0.64
R7842:Bdp1 UTSW 13 100,235,637 (GRCm39) missense probably damaging 1.00
R7850:Bdp1 UTSW 13 100,228,832 (GRCm39) missense probably damaging 1.00
R7904:Bdp1 UTSW 13 100,177,944 (GRCm39) missense probably benign 0.37
R7975:Bdp1 UTSW 13 100,156,884 (GRCm39) missense probably benign 0.01
R7999:Bdp1 UTSW 13 100,195,404 (GRCm39) missense possibly damaging 0.93
R8126:Bdp1 UTSW 13 100,192,790 (GRCm39) missense probably damaging 1.00
R8340:Bdp1 UTSW 13 100,202,476 (GRCm39) missense possibly damaging 0.61
R8414:Bdp1 UTSW 13 100,200,985 (GRCm39) missense probably benign 0.03
R8468:Bdp1 UTSW 13 100,197,076 (GRCm39) missense probably benign 0.04
R8688:Bdp1 UTSW 13 100,240,307 (GRCm39) missense probably damaging 1.00
R8871:Bdp1 UTSW 13 100,186,175 (GRCm39) missense probably damaging 1.00
R8976:Bdp1 UTSW 13 100,197,407 (GRCm39) nonsense probably null
R8987:Bdp1 UTSW 13 100,204,021 (GRCm39) missense probably benign 0.01
R9157:Bdp1 UTSW 13 100,186,436 (GRCm39) missense probably benign 0.40
R9437:Bdp1 UTSW 13 100,162,158 (GRCm39) missense probably benign 0.31
R9612:Bdp1 UTSW 13 100,214,370 (GRCm39) missense probably benign 0.18
R9679:Bdp1 UTSW 13 100,180,285 (GRCm39) missense probably damaging 0.98
RF003:Bdp1 UTSW 13 100,196,958 (GRCm39) missense probably benign 0.31
RF003:Bdp1 UTSW 13 100,196,957 (GRCm39) missense probably benign 0.31
Z1177:Bdp1 UTSW 13 100,197,904 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTAGGTTTCCTGATTAATGTCC -3'
(R):5'- AGCAGCTTCTAACTCACTGC -3'

Sequencing Primer
(F):5'- GCCATATGTCTATACGCCAGTATG -3'
(R):5'- AGCAGCTTCTAACTCACTGCTTTTG -3'
Posted On 2015-07-07