Incidental Mutation 'R4415:Ccdc125'
ID326808
Institutional Source Beutler Lab
Gene Symbol Ccdc125
Ensembl Gene ENSMUSG00000048924
Gene Namecoiled-coil domain containing 125
Synonyms5830436D01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100669717-100697240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100696309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 465 (S465P)
Ref Sequence ENSEMBL: ENSMUSP00000058484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057325] [ENSMUST00000170347]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057325
AA Change: S465P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058484
Gene: ENSMUSG00000048924
AA Change: S465P

DomainStartEndE-ValueType
coiled coil region 101 193 N/A INTRINSIC
coiled coil region 286 308 N/A INTRINSIC
Blast:ETS 362 447 1e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170347
SMART Domains Protein: ENSMUSP00000130107
Gene: ENSMUSG00000048924

DomainStartEndE-ValueType
coiled coil region 101 151 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Ccdc125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Ccdc125 APN 13 100687102 splice site probably benign
IGL02867:Ccdc125 APN 13 100684282 splice site probably benign
R0002:Ccdc125 UTSW 13 100693606 nonsense probably null
R0014:Ccdc125 UTSW 13 100684338 missense possibly damaging 0.82
R0717:Ccdc125 UTSW 13 100690358 missense probably damaging 0.99
R1661:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R1665:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R3118:Ccdc125 UTSW 13 100690319 missense possibly damaging 0.46
R3751:Ccdc125 UTSW 13 100677951 missense possibly damaging 0.90
R4838:Ccdc125 UTSW 13 100677945 missense possibly damaging 0.52
R5734:Ccdc125 UTSW 13 100687114 missense possibly damaging 0.66
R5812:Ccdc125 UTSW 13 100684304 missense probably damaging 1.00
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6419:Ccdc125 UTSW 13 100690326 missense probably damaging 1.00
R6456:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R6733:Ccdc125 UTSW 13 100694487 missense probably benign 0.04
R7183:Ccdc125 UTSW 13 100690358 missense possibly damaging 0.90
R7354:Ccdc125 UTSW 13 100677874 splice site probably null
R7644:Ccdc125 UTSW 13 100678376 splice site probably null
R7910:Ccdc125 UTSW 13 100682819 missense possibly damaging 0.83
R7948:Ccdc125 UTSW 13 100696402 missense probably benign 0.00
R7973:Ccdc125 UTSW 13 100669823 start gained probably benign
X0027:Ccdc125 UTSW 13 100681845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATCAGAGAAAGGTTAGT -3'
(R):5'- ATATAGTTGTTCTTCTGTTTTGGCAA -3'

Sequencing Primer
(F):5'- GAGAAAGGTTAGTTACATGCTCGCTC -3'
(R):5'- CAGACAGTCTTTGCAGTGCTGAAC -3'
Posted On2015-07-07