Incidental Mutation 'R4415:Colq'
ID326809
Institutional Source Beutler Lab
Gene Symbol Colq
Ensembl Gene ENSMUSG00000057606
Gene Namecollagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31523082-31591343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31535688 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 231 (K231E)
Ref Sequence ENSEMBL: ENSMUSP00000121065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112027] [ENSMUST00000150054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112027
AA Change: K241E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107658
Gene: ENSMUSG00000057606
AA Change: K241E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 53 67 N/A INTRINSIC
Pfam:Collagen 91 155 8.8e-11 PFAM
low complexity region 179 191 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
Pfam:Collagen 215 293 3.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150054
AA Change: K231E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121065
Gene: ENSMUSG00000057606
AA Change: K231E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:Collagen 81 143 1.5e-11 PFAM
low complexity region 169 181 N/A INTRINSIC
low complexity region 184 196 N/A INTRINSIC
Pfam:Collagen 202 283 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158616
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit tremors, reduced body weight, lack of asymmetric forms of acetylcholinesterase and butyrylcholinesterase, and lethality prior to maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Colq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Colq APN 14 31535588 critical splice donor site probably null
IGL00832:Colq APN 14 31528346 nonsense probably null
IGL01115:Colq APN 14 31545128 splice site probably benign
IGL01879:Colq APN 14 31543995 missense probably damaging 1.00
IGL02009:Colq APN 14 31535642 missense possibly damaging 0.86
IGL02935:Colq APN 14 31535634 missense probably damaging 0.97
IGL03168:Colq APN 14 31524420 missense probably damaging 1.00
R0288:Colq UTSW 14 31543992 missense possibly damaging 0.89
R0765:Colq UTSW 14 31526037 missense possibly damaging 0.94
R1756:Colq UTSW 14 31547452 missense probably damaging 0.97
R3749:Colq UTSW 14 31549453 unclassified probably benign
R4114:Colq UTSW 14 31557867 start codon destroyed probably benign
R4604:Colq UTSW 14 31545103 missense possibly damaging 0.77
R4628:Colq UTSW 14 31544022 missense probably damaging 1.00
R4749:Colq UTSW 14 31529515 missense possibly damaging 0.91
R4971:Colq UTSW 14 31545077 missense probably damaging 1.00
R5071:Colq UTSW 14 31528832 missense possibly damaging 0.53
R5096:Colq UTSW 14 31552954 missense possibly damaging 0.80
R5181:Colq UTSW 14 31557842 missense probably benign
R5251:Colq UTSW 14 31539819 critical splice donor site probably null
R7059:Colq UTSW 14 31526034 missense probably damaging 0.98
R7075:Colq UTSW 14 31552909 missense probably damaging 1.00
R7355:Colq UTSW 14 31545109 missense probably damaging 1.00
R7490:Colq UTSW 14 31545086 missense possibly damaging 0.93
R7651:Colq UTSW 14 31528335 missense possibly damaging 0.86
R7988:Colq UTSW 14 31553837 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACTCTGTTGGCATCTCCTTG -3'
(R):5'- TGGTCTGAAACTCCACTCCC -3'

Sequencing Primer
(F):5'- CTTGTGGCTTTCCTGGGAGAC -3'
(R):5'- CTTAGTGAGGTCATCAAACTTGC -3'
Posted On2015-07-07