Mutagenetix > Incidental Mutations

Incidental Mutation 'R4415:Rfx2'

326813

Institutional Source

Beutler Lab

Gene Symbol

Rfx2

Ensembl Gene

ENSMUSG00000024206

Gene Name

regulatory factor X, 2 (influences HLA class II expression)

Synonyms

5430432H19Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.714) question?

Stock #

R4415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56775897-56831008 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56787733 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 204 (T204S)

Ref Sequence

ENSEMBL: ENSMUSP00000002444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002444
AA Change: T204S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: T204S

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	4	149	1.9e-50	PFAM
Pfam:RFX_DNA_binding	192	269	4.3e-36	PFAM
Blast:HisKA	479	542	1e-31	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086801
AA Change: T179S

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: T179S

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	151	6.8e-56	PFAM
Pfam:RFX_DNA_binding	161	246	6e-41	PFAM
Blast:HisKA	454	517	1e-31	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
Ace3	A	T	11: 106,005,121	D631V	probably benign	Het
Adam17	T	C	12: 21,345,701	I274V	possibly damaging	Het
Aebp1	A	G	11: 5,865,451	D303G	probably damaging	Het
B020004C17Rik	T	C	14: 57,017,417	*233R	probably null	Het
Bcl9l	C	T	9: 44,501,879	P127S	possibly damaging	Het
Bdp1	T	C	13: 100,030,861	D2215G	probably damaging	Het
Caly	T	C	7: 140,072,680	T52A	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Colq	T	C	14: 31,535,688	K231E	probably damaging	Het
Fam32a	T	A	8: 72,221,941	I77N	probably damaging	Het
Gm597	T	A	1: 28,777,133	Q606L	probably benign	Het
Impdh1	C	T	6: 29,209,222	V49M	probably damaging	Het
Kcnh7	A	G	2: 62,706,073	I1055T	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lama2	G	T	10: 26,989,344	Y947*	probably null	Het
Myo5b	T	A	18: 74,580,408	I108N	probably damaging	Het
Nvl	T	C	1: 181,105,114	T713A	probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Pappa	A	G	4: 65,305,295	T1236A	probably benign	Het
Rcl1	G	A	19: 29,118,362	V116I	probably benign	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor1	T	C	8: 105,617,976	S581P	probably benign	Het
Rnf213	T	A	11: 119,483,964	V5084E	probably damaging	Het
Scn9a	A	T	2: 66,526,693	V1077E	probably damaging	Het
Slc15a5	A	G	6: 138,079,756	V54A	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Snx19	T	A	9: 30,437,483	L804Q	probably damaging	Het
Specc1l	C	A	10: 75,246,328	N519K	possibly damaging	Het
Stambp	A	T	6: 83,557,482	N274K	probably damaging	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Tacc3	T	G	5: 33,666,684		probably null	Het
Tmem55a	C	T	4: 14,912,463	R191C	probably damaging	Het
Tubb1	G	A	2: 174,457,673	E383K	probably benign	Het
Ube3b	A	T	5: 114,412,444	D844V	probably damaging	Het

Other mutations in Rfx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Rfx2	APN	17	56783657	missense	probably damaging	1.00
IGL01296:Rfx2	APN	17	56808317	start codon destroyed	possibly damaging	0.81
IGL01488:Rfx2	APN	17	56805398	missense	probably damaging	1.00
IGL01705:Rfx2	APN	17	56785303	missense	possibly damaging	0.88
IGL02389:Rfx2	APN	17	56808325	splice site	probably benign
IGL02601:Rfx2	APN	17	56785354	missense	possibly damaging	0.75
IGL02609:Rfx2	APN	17	56805404	missense	probably benign	0.00
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0197:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R0370:Rfx2	UTSW	17	56799308	missense	probably benign	0.03
R0413:Rfx2	UTSW	17	56784418	splice site	probably benign
R0622:Rfx2	UTSW	17	56777071	missense	probably damaging	0.99
R0883:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R1429:Rfx2	UTSW	17	56804369	missense	probably damaging	0.97
R1439:Rfx2	UTSW	17	56787720	missense	probably damaging	1.00
R1569:Rfx2	UTSW	17	56804326	missense	possibly damaging	0.63
R1654:Rfx2	UTSW	17	56808263	missense	probably benign	0.00
R1751:Rfx2	UTSW	17	56784754	missense	probably benign	0.01
R1816:Rfx2	UTSW	17	56808305	nonsense	probably null
R2282:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R3408:Rfx2	UTSW	17	56803526	missense	probably benign	0.00
R3962:Rfx2	UTSW	17	56785302	missense	probably damaging	0.99
R4876:Rfx2	UTSW	17	56784706	missense	probably benign	0.00
R4883:Rfx2	UTSW	17	56783747	missense	probably damaging	0.98
R5588:Rfx2	UTSW	17	56779890	missense	possibly damaging	0.69
R5766:Rfx2	UTSW	17	56803587	missense	probably benign	0.02
R5798:Rfx2	UTSW	17	56804362	missense	possibly damaging	0.89
R5931:Rfx2	UTSW	17	56780778	missense	probably damaging	0.99
R6061:Rfx2	UTSW	17	56777473	missense	possibly damaging	0.86
R6466:Rfx2	UTSW	17	56784397	missense	probably benign	0.13
R6800:Rfx2	UTSW	17	56780804	missense	probably damaging	0.99
R7329:Rfx2	UTSW	17	56803681	missense	probably benign	0.05
R7476:Rfx2	UTSW	17	56803527	missense	probably benign	0.31
R8159:Rfx2	UTSW	17	56803605	missense	probably benign	0.43
R8274:Rfx2	UTSW	17	56804348	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGGTCTCTGACATGGGAAG -3'
(R):5'- CAGCCTAGAGATGTGGTGTG -3'

Sequencing Primer
(F):5'- CATGAGATGCAGGGAGCCC -3'
(R):5'- AAGCTGCACCTGGATGCATG -3'

Posted On

2015-07-07