Incidental Mutation 'R4416:Icos'
ID 326816
Institutional Source Beutler Lab
Gene Symbol Icos
Ensembl Gene ENSMUSG00000026009
Gene Name inducible T cell co-stimulator
Synonyms
MMRRC Submission 041137-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R4416 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 60977927-61000320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60994690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 160 (I160L)
Ref Sequence ENSEMBL: ENSMUSP00000027162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027162] [ENSMUST00000102827]
AlphaFold Q9WVS0
Predicted Effect probably benign
Transcript: ENSMUST00000027162
AA Change: I160L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027162
Gene: ENSMUSG00000026009
AA Change: I160L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V-set_2 23 135 7.5e-59 PFAM
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102827
AA Change: I160L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099891
Gene: ENSMUSG00000026009
AA Change: I160L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V-set_2 23 135 3.6e-59 PFAM
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193733
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CD28 and CTLA-4 cell-surface receptor family. It forms homodimers and plays an important role in cell-cell signaling, immune responses, and regulation of cell proliferation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show reduced basal IgG1 levels and impaired interactions between T and B cells. T cell dependent B cell isotype switching was impaired as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Icos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03109:Icos APN 1 60997697 splice site probably benign
R1416:Icos UTSW 1 60994643 missense probably damaging 1.00
R4751:Icos UTSW 1 60993717 missense probably benign 0.01
R4998:Icos UTSW 1 60993782 missense possibly damaging 0.74
R6598:Icos UTSW 1 60994697 missense possibly damaging 0.78
R7169:Icos UTSW 1 60995546 missense probably damaging 1.00
R8357:Icos UTSW 1 60993856 missense probably damaging 1.00
R8457:Icos UTSW 1 60993856 missense probably damaging 1.00
R8537:Icos UTSW 1 60993942 missense probably damaging 1.00
R9178:Icos UTSW 1 60995555 missense probably damaging 1.00
R9517:Icos UTSW 1 60993735 missense probably damaging 1.00
R9578:Icos UTSW 1 60993712 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGCACCACCTATTAGTCACATTTG -3'
(R):5'- ACCTTGTGAGGAAAATGCATGG -3'

Sequencing Primer
(F):5'- CACATTTGTAAACACACTAGATTCG -3'
(R):5'- CTCTGAGAAGCATCTGTCA -3'
Posted On 2015-07-07