Mutagenetix > Incidental Mutations

Incidental Mutation 'R4416:Rab3gap2'

326818

Institutional Source

Beutler Lab

Gene Symbol

Rab3gap2

Ensembl Gene

ENSMUSG00000039318

Gene Name

RAB3 GTPase activating protein subunit 2

Synonyms

1110059F07Rik

MMRRC Submission

041137-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

185204117-185286759 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 185282347 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1231 (D1231V)

Ref Sequence

ENSEMBL: ENSMUSP00000066325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000069652] [ENSMUST00000194740]

Predicted Effect

probably benign
Transcript: ENSMUST00000027921

SMART Domains

Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
Pfam:tRNA-synt_1	87	712	3.6e-172	PFAM
Pfam:tRNA-synt_1g	112	268	7e-15	PFAM
Pfam:tRNA-synt_1_2	334	462	3.8e-7	PFAM
Pfam:Anticodon_1	756	920	1.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000069652
AA Change: D1231V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: D1231V

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-167	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	767	1366	3.2e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131770

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193482

Predicted Effect

probably benign
Transcript: ENSMUST00000194740
AA Change: D1211V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: D1211V

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-157	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	766	1346	2.5e-233	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195534

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Rab3gap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Rab3gap2	APN	1	185238870	missense	probably damaging	1.00
IGL01620:Rab3gap2	APN	1	185204326	missense	probably benign
IGL01977:Rab3gap2	APN	1	185267023	nonsense	probably null
IGL02183:Rab3gap2	APN	1	185271468	nonsense	probably null
IGL02229:Rab3gap2	APN	1	185259383	missense	possibly damaging	0.71
IGL02231:Rab3gap2	APN	1	185266898	splice site	probably benign
IGL02506:Rab3gap2	APN	1	185252024	splice site	probably benign
IGL02618:Rab3gap2	APN	1	185251741	missense	possibly damaging	0.79
IGL02643:Rab3gap2	APN	1	185267000	missense	possibly damaging	0.69
IGL03239:Rab3gap2	APN	1	185249894	missense	probably damaging	1.00
PIT4498001:Rab3gap2	UTSW	1	185281685	missense	probably damaging	1.00
R0173:Rab3gap2	UTSW	1	185249907	missense	possibly damaging	0.51
R0372:Rab3gap2	UTSW	1	185262694	missense	possibly damaging	0.93
R0492:Rab3gap2	UTSW	1	185252392	splice site	probably benign
R0510:Rab3gap2	UTSW	1	185260508	splice site	probably benign
R0708:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R0711:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R1135:Rab3gap2	UTSW	1	185275943	missense	possibly damaging	0.95
R1428:Rab3gap2	UTSW	1	185247904	missense	probably damaging	1.00
R1599:Rab3gap2	UTSW	1	185251026	missense	probably benign	0.07
R1758:Rab3gap2	UTSW	1	185283884	missense	probably benign	0.13
R1903:Rab3gap2	UTSW	1	185221902	missense	probably benign
R1929:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R1994:Rab3gap2	UTSW	1	185236024	missense	probably damaging	1.00
R2010:Rab3gap2	UTSW	1	185278281	missense	possibly damaging	0.57
R2102:Rab3gap2	UTSW	1	185282389	missense	probably benign	0.00
R2120:Rab3gap2	UTSW	1	185261367	missense	possibly damaging	0.95
R2219:Rab3gap2	UTSW	1	185275916	missense	probably damaging	0.99
R2259:Rab3gap2	UTSW	1	185221859	missense	probably damaging	1.00
R2270:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R2272:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R3083:Rab3gap2	UTSW	1	185204269	missense	probably benign	0.00
R3776:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R4050:Rab3gap2	UTSW	1	185272643	critical splice donor site	probably null
R4130:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R4176:Rab3gap2	UTSW	1	185246666	missense	probably damaging	0.99
R4296:Rab3gap2	UTSW	1	185255837	critical splice donor site	probably null
R4426:Rab3gap2	UTSW	1	185235342	missense	probably damaging	1.00
R4516:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4518:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4891:Rab3gap2	UTSW	1	185259366	missense	probably benign	0.00
R4913:Rab3gap2	UTSW	1	185262829	missense	probably benign	0.12
R4955:Rab3gap2	UTSW	1	185267155	intron	probably benign
R5411:Rab3gap2	UTSW	1	185277145	critical splice acceptor site	probably null
R5516:Rab3gap2	UTSW	1	185235487	missense	probably benign	0.02
R5670:Rab3gap2	UTSW	1	185221899	missense	probably benign
R5670:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R6380:Rab3gap2	UTSW	1	185235984	missense	probably damaging	1.00
R6533:Rab3gap2	UTSW	1	185232954	splice site	probably null
R6655:Rab3gap2	UTSW	1	185250011	missense	probably damaging	1.00
R6676:Rab3gap2	UTSW	1	185283410	missense	probably damaging	1.00
R6726:Rab3gap2	UTSW	1	185247865	missense	probably damaging	0.99
R6969:Rab3gap2	UTSW	1	185236012	missense	probably damaging	1.00
R7151:Rab3gap2	UTSW	1	185248053	missense	probably benign	0.00
R7168:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R7196:Rab3gap2	UTSW	1	185281667	missense	probably damaging	1.00
R7201:Rab3gap2	UTSW	1	185267191	missense	probably damaging	1.00
R7371:Rab3gap2	UTSW	1	185251068	missense	probably damaging	1.00
R7573:Rab3gap2	UTSW	1	185282382	missense	probably benign
R7779:Rab3gap2	UTSW	1	185259444	missense	probably damaging	0.98
R7913:Rab3gap2	UTSW	1	185262816	missense	possibly damaging	0.88
R7922:Rab3gap2	UTSW	1	185249920	missense	probably benign	0.00
R8115:Rab3gap2	UTSW	1	185267250	missense	possibly damaging	0.90
R8203:Rab3gap2	UTSW	1	185267179	missense	probably damaging	1.00
R8242:Rab3gap2	UTSW	1	185221853	missense	probably benign
R8322:Rab3gap2	UTSW	1	185246680	missense	probably benign	0.42
R8360:Rab3gap2	UTSW	1	185267073	intron	probably benign
R8515:Rab3gap2	UTSW	1	185262820	missense	probably benign	0.15
R8678:Rab3gap2	UTSW	1	185251084	missense	probably damaging	1.00
R8833:Rab3gap2	UTSW	1	185258525	missense	probably damaging	1.00
Z1088:Rab3gap2	UTSW	1	185281677	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGTGGCAATGAGTATGGAG -3'
(R):5'- AGAGGCCAATGAGCATCTCG -3'

Sequencing Primer
(F):5'- CAGCTCTGGGGTTAGTTCTCC -3'
(R):5'- AATGAGCATCTCGGGCCACTC -3'

Posted On

2015-07-07