Incidental Mutation 'R4416:Cdk9'
ID326820
Institutional Source Beutler Lab
Gene Symbol Cdk9
Ensembl Gene ENSMUSG00000009555
Gene Namecyclin-dependent kinase 9 (CDC2-related kinase)
SynonymsPITALRE
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32705784-32713076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32708072 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 273 (L273P)
Ref Sequence ENSEMBL: ENSMUSP00000113327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009699] [ENSMUST00000120105] [ENSMUST00000123170] [ENSMUST00000127812] [ENSMUST00000143743] [ENSMUST00000146498] [ENSMUST00000154131] [ENSMUST00000155205]
Predicted Effect probably damaging
Transcript: ENSMUST00000009699
AA Change: L324P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009699
Gene: ENSMUSG00000009555
AA Change: L324P

DomainStartEndE-ValueType
S_TKc 19 315 9.28e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120105
AA Change: L273P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113327
Gene: ENSMUSG00000009555
AA Change: L273P

DomainStartEndE-ValueType
Pfam:Pkinase 1 264 9.8e-58 PFAM
Pfam:Pkinase_Tyr 2 215 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125058
Predicted Effect probably benign
Transcript: ENSMUST00000127812
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130399
Predicted Effect probably benign
Transcript: ENSMUST00000143743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144210
Predicted Effect probably benign
Transcript: ENSMUST00000146498
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154131
SMART Domains Protein: ENSMUSP00000120857
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 19 61 8.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155205
SMART Domains Protein: ENSMUSP00000115299
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 1 54 8.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198213
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Cdk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Cdk9 APN 2 32708051 missense possibly damaging 0.77
R0321:Cdk9 UTSW 2 32712686 unclassified probably benign
R0615:Cdk9 UTSW 2 32709801 missense possibly damaging 0.92
R0624:Cdk9 UTSW 2 32709824 missense probably damaging 1.00
R0661:Cdk9 UTSW 2 32709820 missense probably damaging 1.00
R1525:Cdk9 UTSW 2 32710509 missense probably damaging 0.97
R2082:Cdk9 UTSW 2 32709501 missense probably damaging 1.00
R6047:Cdk9 UTSW 2 32708273 unclassified probably null
R7391:Cdk9 UTSW 2 32712071 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATGTTCCATGCAAAGGAAGC -3'
(R):5'- AGCTGTTTGAAAAGCTGGAAC -3'

Sequencing Primer
(F):5'- GAAGCAATCCACTCCTAACCTAAG -3'
(R):5'- CTGGAACTTGTGAAGGGCC -3'
Posted On2015-07-07