Incidental Mutation 'R4416:Nudt6'
ID326825
Institutional Source Beutler Lab
Gene Symbol Nudt6
Ensembl Gene ENSMUSG00000050174
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 6
Synonyms
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37404910-37420211 bp(-) (GRCm38)
Type of Mutationunclassified (127 bp from exon)
DNA Base Change (assembly) A to T at 37405229 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038885] [ENSMUST00000052645] [ENSMUST00000091203] [ENSMUST00000099130] [ENSMUST00000108117] [ENSMUST00000108118] [ENSMUST00000108120] [ENSMUST00000138563] [ENSMUST00000141438] [ENSMUST00000146324] [ENSMUST00000149449] [ENSMUST00000200585]
Predicted Effect probably benign
Transcript: ENSMUST00000038885
SMART Domains Protein: ENSMUSP00000037694
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Predicted Effect probably null
Transcript: ENSMUST00000052645
AA Change: Y270*
SMART Domains Protein: ENSMUSP00000056219
Gene: ENSMUSG00000050174
AA Change: Y270*

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 270 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091203
SMART Domains Protein: ENSMUSP00000088742
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 3 109 3.67e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099130
AA Change: Y269*
SMART Domains Protein: ENSMUSP00000096733
Gene: ENSMUSG00000050174
AA Change: Y269*

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 1e-42 PDB
Pfam:NUDIX 139 269 7.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108117
SMART Domains Protein: ENSMUSP00000103752
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 76 3e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000108118
AA Change: Y202*
SMART Domains Protein: ENSMUSP00000103753
Gene: ENSMUSG00000050174
AA Change: Y202*

DomainStartEndE-ValueType
Pfam:NUDIX 73 202 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108120
SMART Domains Protein: ENSMUSP00000103755
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 3 106 3.19e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133894
Predicted Effect probably benign
Transcript: ENSMUST00000138563
SMART Domains Protein: ENSMUSP00000122227
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138710
Predicted Effect probably null
Transcript: ENSMUST00000141438
AA Change: Y54*
SMART Domains Protein: ENSMUSP00000142588
Gene: ENSMUSG00000050174
AA Change: Y54*

DomainStartEndE-ValueType
PDB:3H95|A 2 97 5e-55 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145228
Predicted Effect probably null
Transcript: ENSMUST00000146324
AA Change: Y104*
SMART Domains Protein: ENSMUSP00000142653
Gene: ENSMUSG00000050174
AA Change: Y104*

DomainStartEndE-ValueType
Pfam:NUDIX 1 104 6.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149449
SMART Domains Protein: ENSMUSP00000116572
Gene: ENSMUSG00000050174

DomainStartEndE-ValueType
PDB:3FXT|H 42 131 3e-44 PDB
PDB:3H95|A 132 191 6e-22 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150021
Predicted Effect probably benign
Transcript: ENSMUST00000198158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199938
Predicted Effect probably benign
Transcript: ENSMUST00000200585
SMART Domains Protein: ENSMUSP00000143094
Gene: ENSMUSG00000037225

DomainStartEndE-ValueType
FGF 25 151 2.08e-65 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Nudt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Nudt6 APN 3 37405171 missense probably benign 0.03
IGL02965:Nudt6 APN 3 37419506 missense probably damaging 0.99
IGL02975:Nudt6 APN 3 37419518 missense probably damaging 1.00
R0927:Nudt6 UTSW 3 37405353 missense probably benign 0.01
R1884:Nudt6 UTSW 3 37412400 missense probably benign 0.02
R1939:Nudt6 UTSW 3 37405230 missense probably damaging 1.00
R2122:Nudt6 UTSW 3 37412405 missense probably benign 0.01
R4801:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R4802:Nudt6 UTSW 3 37405354 missense probably benign 0.01
R5826:Nudt6 UTSW 3 37419468 missense probably benign 0.05
R6362:Nudt6 UTSW 3 37419489 missense possibly damaging 0.66
R7887:Nudt6 UTSW 3 37412380 missense possibly damaging 0.95
R7970:Nudt6 UTSW 3 37412380 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TATGTGAGAAAACTGGCGTCAG -3'
(R):5'- GGTGTCAAGTCAGAATTCAGGTC -3'

Sequencing Primer
(F):5'- ACTGGCGTCAGGTTGAAATC -3'
(R):5'- CAAGTCAGAATTCAGGTCCCTGTTG -3'
Posted On2015-07-07