Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Rapgef2'

326827

Institutional Source

Beutler Lab

Gene Symbol

Rapgef2

Ensembl Gene

ENSMUSG00000062232

Gene Name

Rap guanine nucleotide exchange factor (GEF) 2

Synonyms

CNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79062516-79286517 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 79069057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 1481 (G1481*)

Ref Sequence

ENSEMBL: ENSMUSP00000141542 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]

AlphaFold

Q8CHG7

Predicted Effect

probably null
Transcript: ENSMUST00000118100
AA Change: G1333*

SMART Domains

Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: G1333*

Domain	Start	End	E-Value	Type
low complexity region	38	62	N/A	INTRINSIC
low complexity region	84	95	N/A	INTRINSIC
cNMP	135	253	2.48e-15	SMART
RasGEFN	267	380	1.3e-31	SMART
PDZ	395	467	1.28e-12	SMART
RA	606	692	7.59e-23	SMART
RasGEF	713	950	6.09e-100	SMART
low complexity region	1030	1046	N/A	INTRINSIC
low complexity region	1110	1124	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
low complexity region	1392	1405	N/A	INTRINSIC
low complexity region	1440	1455	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000118340
AA Change: G1331*

SMART Domains

Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: G1331*

Domain	Start	End	E-Value	Type
low complexity region	36	60	N/A	INTRINSIC
low complexity region	82	93	N/A	INTRINSIC
cNMP	133	251	2.48e-15	SMART
RasGEFN	265	378	1.3e-31	SMART
PDZ	393	465	1.28e-12	SMART
RA	604	690	7.59e-23	SMART
RasGEF	711	948	6.09e-100	SMART
low complexity region	1028	1044	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1138	1159	N/A	INTRINSIC
low complexity region	1390	1403	N/A	INTRINSIC
low complexity region	1438	1453	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000195708
AA Change: G1481*

SMART Domains

Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: G1481*

Domain	Start	End	E-Value	Type
cNMP	24	131	3.9e-4	SMART
low complexity region	186	210	N/A	INTRINSIC
low complexity region	232	243	N/A	INTRINSIC
cNMP	283	401	1.2e-17	SMART
RasGEFN	415	528	6.4e-34	SMART
PDZ	543	615	6.4e-15	SMART
RA	754	840	4.8e-25	SMART
RasGEF	861	1098	3.8e-102	SMART
low complexity region	1178	1194	N/A	INTRINSIC
low complexity region	1258	1272	N/A	INTRINSIC
low complexity region	1288	1309	N/A	INTRINSIC
low complexity region	1540	1553	N/A	INTRINSIC
low complexity region	1588	1603	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Rapgef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rapgef2	APN	3	79092025	missense	possibly damaging	0.89
IGL01024:Rapgef2	APN	3	79070138	missense	probably benign	0.43
IGL01448:Rapgef2	APN	3	79068937	missense	probably benign
IGL01448:Rapgef2	APN	3	79103962	critical splice donor site	probably null
IGL01928:Rapgef2	APN	3	79103963	missense	probably damaging	1.00
IGL01973:Rapgef2	APN	3	79091809	splice site	probably null
IGL02015:Rapgef2	APN	3	79092064	splice site	probably benign
IGL02498:Rapgef2	APN	3	79066753	missense	probably damaging	0.97
IGL02631:Rapgef2	APN	3	79083226	missense	possibly damaging	0.77
IGL02835:Rapgef2	APN	3	79092986	splice site	probably benign
IGL02887:Rapgef2	APN	3	79068880	splice site	probably benign
IGL03030:Rapgef2	APN	3	79074307	critical splice donor site	probably null
IGL03035:Rapgef2	APN	3	79094424	missense	probably damaging	1.00
IGL03222:Rapgef2	APN	3	79087995	missense	probably damaging	1.00
IGL03227:Rapgef2	APN	3	79092613	splice site	probably benign
IGL03326:Rapgef2	APN	3	79091833	missense	probably damaging	0.96
IGL03335:Rapgef2	APN	3	79099185	missense	probably damaging	1.00
IGL03384:Rapgef2	APN	3	79083546	missense	probably damaging	1.00
Bulge	UTSW	3	79079132	missense	probably benign	0.01
Hai_phat	UTSW	3	79085959	missense	probably damaging	1.00
R0022:Rapgef2	UTSW	3	79087900	missense	probably damaging	1.00
R0022:Rapgef2	UTSW	3	79087900	missense	probably damaging	1.00
R0038:Rapgef2	UTSW	3	79069396	missense	probably benign	0.00
R0117:Rapgef2	UTSW	3	79079177	missense	probably benign	0.00
R0225:Rapgef2	UTSW	3	79104105	missense	probably damaging	0.99
R0723:Rapgef2	UTSW	3	79079174	missense	probably benign	0.20
R0788:Rapgef2	UTSW	3	79099195	missense	possibly damaging	0.59
R1311:Rapgef2	UTSW	3	79083547	missense	probably benign	0.12
R1374:Rapgef2	UTSW	3	79087968	missense	probably benign	0.08
R1507:Rapgef2	UTSW	3	79081293	splice site	probably benign
R1523:Rapgef2	UTSW	3	79092749	missense	probably damaging	1.00
R1753:Rapgef2	UTSW	3	79088791	missense	possibly damaging	0.65
R1759:Rapgef2	UTSW	3	79066731	missense	possibly damaging	0.89
R1766:Rapgef2	UTSW	3	79092703	missense	probably damaging	1.00
R2436:Rapgef2	UTSW	3	79088772	missense	possibly damaging	0.95
R3033:Rapgef2	UTSW	3	79074306	critical splice donor site	probably null
R3766:Rapgef2	UTSW	3	79088750	missense	probably benign	0.01
R4118:Rapgef2	UTSW	3	79068887	critical splice donor site	probably null
R4722:Rapgef2	UTSW	3	79069173	missense	probably benign	0.00
R4743:Rapgef2	UTSW	3	79173068	missense	probably damaging	0.99
R4780:Rapgef2	UTSW	3	79169769	splice site	probably benign
R4825:Rapgef2	UTSW	3	79083227	missense	probably benign	0.03
R4861:Rapgef2	UTSW	3	79074436	missense	probably benign	0.01
R4861:Rapgef2	UTSW	3	79074436	missense	probably benign	0.01
R4900:Rapgef2	UTSW	3	79074363	missense	probably benign	0.02
R4943:Rapgef2	UTSW	3	79064547	missense	probably benign	0.00
R5291:Rapgef2	UTSW	3	79070059	missense	possibly damaging	0.64
R5369:Rapgef2	UTSW	3	79069432	missense	probably benign	0.00
R5413:Rapgef2	UTSW	3	79087866	missense	probably damaging	1.00
R5561:Rapgef2	UTSW	3	79088643	critical splice donor site	probably null
R5568:Rapgef2	UTSW	3	79104001	missense	probably damaging	1.00
R5642:Rapgef2	UTSW	3	79094850	missense	probably damaging	1.00
R5783:Rapgef2	UTSW	3	79087993	missense	probably benign	0.00
R6041:Rapgef2	UTSW	3	79069162	missense	probably benign	0.00
R6193:Rapgef2	UTSW	3	79069444	missense	possibly damaging	0.48
R6324:Rapgef2	UTSW	3	79079132	missense	probably benign	0.01
R6551:Rapgef2	UTSW	3	79215035	splice site	probably null
R6688:Rapgef2	UTSW	3	79069128	missense	probably benign	0.03
R6908:Rapgef2	UTSW	3	79104063	missense	probably benign	0.01
R6913:Rapgef2	UTSW	3	79085974	missense	probably damaging	1.00
R6933:Rapgef2	UTSW	3	79085959	missense	probably damaging	1.00
R7086:Rapgef2	UTSW	3	79086046	missense	probably benign	0.08
R7106:Rapgef2	UTSW	3	79066608	missense	probably benign
R7228:Rapgef2	UTSW	3	79069218	missense	probably benign	0.03
R7242:Rapgef2	UTSW	3	79087903	nonsense	probably null
R7257:Rapgef2	UTSW	3	79082627	missense	probably damaging	0.99
R7322:Rapgef2	UTSW	3	79145823	start codon destroyed	probably null	0.02
R7443:Rapgef2	UTSW	3	79081224	missense	probably damaging	1.00
R7450:Rapgef2	UTSW	3	79173059	missense	probably benign	0.01
R7472:Rapgef2	UTSW	3	79069273	missense	probably benign	0.45
R7884:Rapgef2	UTSW	3	79066626	missense	possibly damaging	0.49
R7954:Rapgef2	UTSW	3	79070147	nonsense	probably null
R7957:Rapgef2	UTSW	3	79214969	missense	probably benign	0.27
R8071:Rapgef2	UTSW	3	79093036	missense	probably damaging	1.00
R8261:Rapgef2	UTSW	3	79086018	missense	probably benign	0.34
R8268:Rapgef2	UTSW	3	79085956	missense	probably benign	0.12
R8309:Rapgef2	UTSW	3	79083202	missense	possibly damaging	0.65
R8505:Rapgef2	UTSW	3	79079042	nonsense	probably null
R8783:Rapgef2	UTSW	3	79098344	missense	probably damaging	1.00
R8897:Rapgef2	UTSW	3	79112259	missense	probably damaging	1.00
R8965:Rapgef2	UTSW	3	79092544	missense	probably damaging	1.00
R9028:Rapgef2	UTSW	3	79074344	missense	probably damaging	1.00
R9284:Rapgef2	UTSW	3	79092703	missense	probably damaging	1.00
R9371:Rapgef2	UTSW	3	79174993	missense	probably damaging	1.00
R9479:Rapgef2	UTSW	3	79112188	missense	probably damaging	1.00
R9493:Rapgef2	UTSW	3	79112188	missense	probably damaging	1.00
R9494:Rapgef2	UTSW	3	79112188	missense	probably damaging	1.00
R9500:Rapgef2	UTSW	3	79066786	missense	probably benign
R9657:Rapgef2	UTSW	3	79091884	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGCCATGGTTCAGGTGTG -3'
(R):5'- CCATTTGGGCACACTCACTTTG -3'

Sequencing Primer
(F):5'- CATTTCCACACTTACCGATGAG -3'
(R):5'- CACTCACTTTGACTATTCAGGGGATG -3'

Posted On

2015-07-07